We narrowed to 15,086 results for: NTS;
-
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-ASAP5-Kv2.1-WPRE
Plasmid#225707PurposePan-neuronal soma-targeted expression of the genetically encoded voltage indicator ASAP5DepositorHas ServiceAAV1InsertASAP5-Kv2.1
UseAAVPromoterhuman synapsinAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1-FOXM1b
Plasmid#68811PurposeDoxycycline inducible lentiviral vector for FOXM1b expression in mammalian cellsDepositorInsertFOXM1b (FOXM1 Human)
UseLentiviral; Doxycycline inducibleTagsHAExpressionMammalianPromoterTRE promoter, Tet ONAvailable SinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-Dio-ASAP5-Kv2.1-WPRE
Plasmid#225708PurposeCre dependent soma-targeted expression of the genetically encoded voltage indicator ASAP5DepositorHas ServiceAAV9InsertASAP5-Kv2.1
UseAAVPromoterEF1αAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHSN6A01
Plasmid#50586PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-VP64, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertsdCas9-VP64
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSMutationdCas9 = defective in DNA cleavage; 4×minimal VP16…Promoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCC_05 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-dCas9-NLS-VPR-2A-Puro-WPRE
Plasmid#139090PurposeExpresses human codon-optimized inactive SpCas9 fused to a transcriptional activator VPR in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a barcode downstream of sgRNA cassette.DepositorInsertdSpCas9-VPR
UseCRISPR and LentiviralExpressionMammalianMutationD10A, H840AAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynapsin.SF-iGluSnFR.A184S
Plasmid#106174PurposeTight affinity glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorHas ServiceAAV1 and AAV9InsertSF-iGluSnFR.A184S
UseAAVMutationGltI: A184SPromoterhSynapsinAvailable SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
AttB_ACE2_IRES-mCherry-H2A-P2A-PuroR
Plasmid#171594PurposeStrong human ACE2 abundance from Bxb1 landing padDepositorInsertsUseSynthetic Biology; Promoterless bxb1 dna recombin…ExpressionMammalianAvailable SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1-FOXM1c
Plasmid#68810PurposeDoxycycline inducible lentiviral vector for FOXM1c expression in mammalian cellsDepositorInsertFOXM1c (FOXM1 Human)
UseLentiviral; Doxycycline inducibleTagsFLAGExpressionMammalianPromoterTRE promoter, Tet ONAvailable SinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-NPM1
Plasmid#237667PurposeFor overexpression of mEGFP-NPM1DepositorAvailable SinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
YFP NLS Beta-Actin
Plasmid#60613PurposeEncodes YFP and NLS tagged beta-actinDepositorAvailable SinceNov. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
Lenti-pHSE::Cre-mRuby3
Plasmid#164136PurposeLentiviral construct for building stable cell lines expressing Cre recombinase and mRuby3 in the presence of heat inductionDepositorInsertHSE promoter-Cre-T2A-mRuby3
UseCRISPR, Cre/Lox, Lentiviral, and Synthetic Biolog…ExpressionMammalianPromoterHSE synthetic promoterAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-2NLS-Cas9-6XMS2
Plasmid#166033PurposeExpression of 6X MS2 stem loops fused SpCas9 mRNA for packaging of SpCas9 mRNA within lentiviral particles.DepositorInsertSpCas9
UseCRISPR and LentiviralPromoterCMVAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
CMV-LUC2CP/intron/ARE
Plasmid#62858Purposesplicing reporter (with intron) with elements to shorten the half-life of the luciferase protein as well as the luciferase mRNA.DepositorInsertLuciferase
UseLuciferaseExpressionMammalianMutationinsertion of chimeric intron at nueotide poclsiti…PromoterCMVAvailable SinceApril 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SaPE2
Plasmid#174817PurposeMammalian expression of SaCas9 prime editor 2DepositorInsertSaPE2
TagsSV40 bpNLSExpressionMammalianMutationDetailed in manuscriptPromoterCMVAvailable SinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET-TRSter
Plasmid#78865PurposeExpresses rat Thioredoxin Reductase using an open reading frame in fusion with a mutated E. coli-type SECIS elementDepositorInsertThioredoxin Reductase (Txnrd1 Rat)
TagsMutated E. coli-type SECIS element (3’ end of ins…ExpressionBacterialPromoterT7lacAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
Luciferase
Plasmid#213979PurposeExpresses Doxy Inducible LuciferaseDepositorInsertLuciferase
UseLentiviralTags6xHis affinity tagExpressionBacterial and MammalianPromoterTet-responsive promoter PTight, consisting of sev…Available SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiPGK Blast DEST JNKKTRmRuby2
Plasmid#59154PurposeLentiviral vector to express JNK KTR mRuby2 under PGK promoter (With Blasticidin Resistance)DepositorInsertJNK Kinase Translocation Reporter (MAPK8 Human)
UseLentiviralTagsmRuby2ExpressionMammalianPromoterPGKAvailable SinceSept. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
WT Smarca4-sfGFP
Plasmid#107056PurposeExpression of wild-type Smarca4 (Brg1) with C-terminal super-folder GFP fusion.DepositorInsertSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 (Smarca4 Mouse)
UseLentiviralTagsSuper-folder GFP (sfGFP)ExpressionMammalianMutationwild-typePromoterCAGAvailable SinceApril 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHSN6I01
Plasmid#50587PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-KRAB, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertsdCas9-KRAB
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSMutationdCas9 that is defective in DNA cleavage; the maiz…Promoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only