We narrowed to 3,608 results for: cmv promoter
-
Plasmid#250386PurposeLentiviral expression of human NUDT5 with N-terminal mCherry seperated by a flexible GSG-linker and P2A under CMV promoter, as well as a puromycin resistance cassette under PGK promoter.DepositorAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only
-
Click editor utilizing mSA for template recruitment and ePhi29 DNA polymerase - pCMV-T7-mSA-nCas9-ePhi29 (JO1398)
Plasmid#217803PurposeVariant CE1 construct with mSA for template recruitment and ePhi29(D169A) DNA pol, expressed from CMV or T7 promoters.DepositorInsertmSA-linker-SV40NLS-nSpCas9-BPNLS-ePhi29-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); Phi29(D169A/M8R/V51A/M97T/G197D/E…PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV mCherry-GFP-LC3B WT
Plasmid#123230PurposeExpresses mCherry-EGFP-LC3B wild-type in mammalian cells. Fluorescent tandem reporter for autophagosomes. High expression driven by CMV promoter.DepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
TagsEGFP and mCherryExpressionMammalianPromoterCMVAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC385 - pAAV CMV-IE IRES EGFP
Plasmid#102936PurposeAn AAV vector that expresses IRES EGFP under the CMV-IE promoterDepositorInsertEGFP
UseAAVExpressionMammalianPromoterCMV-IEAvailable SinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-MFSD6-mNeon-Puro
Plasmid#239955PurposeLentiviral vector to generate mNeon-tagged MFSD6 stable expressing cell line under CMV promoterDepositorInsertMFSD6-mNeon
UseLentiviralTagsmNeonExpressionMammalianAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CMV-FLAG-CFP-AMOT
Plasmid#235682PurposeExpress CFP tagged AMOT gene in mammalian cells using the CMV promoterDepositorAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMVp-dCas9-3xNLS-VP64 (Construct 1)
Plasmid#55195PurposeExpresses taCas9 in Mammalian cells for transactivating endogenous and synthetic promoters. The backbone is a lentiviral vector.DepositorInsertdCas9
UseCRISPR and Synthetic BiologyTagsVP64ExpressionMammalianPromoterCMV/hUBCAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR CMV Renilla Luciferase L5-L2
Plasmid#62186PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a CMV promoter and renilla luciferase module. Compatible with MultiSite Gateway cloningDepositorInsertRenilla luciferase
UseLuciferase; Mule gateway entry vectorExpressionMammalianPromoterCMVAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hAcrVA1-NLS(sv40) (BPK5050)
Plasmid#115136PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA1 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA1 anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 SV40-CMV-SaCas9-3xNLS
Plasmid#78601PurposeAAV vector containing SaCas9DepositorInsertSV40-CMV-SaCas9-3xNLS
UseAAV and CRISPRTagsHA tagExpressionMammalianPromoterSV40, CMV promotersAvailable SinceDec. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 1 CMV EYFP Tubulin
Plasmid#206254PurposeENTR Vector 1 for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes EYFP Tubulin under the control of CMV promoter.DepositorInsertEYFP Tubulin
UseMultimate/gateway entr 1TagsEYFPExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 2 CMV mTFP1 Actin
Plasmid#206255PurposeENTR Vector 2 for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes mTFP1 Actin under the control of CMV promoter.DepositorInsertmTFP1 Actin
UseMultimate/gateway entr 2TagsmTFP1ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 3 CMV mito mCherry
Plasmid#206256PurposeENTR Vector 3 for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes mitochondrially localised mCherry under the control of CMV promoter.DepositorInsertmito mCherry
UseMultimate/gateway entr 3TagsCOX8 mitochondrial tagExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR CMV Luc2 (FF-Luciferase) L5-L2
Plasmid#62168PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a CMV promoter and firefly luciferase module. Compatible with MultiSite Gateway cloningDepositorInsertLuciferase
UseLuciferase; Mule gateway entry vectorExpressionMammalianPromoterCMVAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hAcrVA2.1-NLS(sv40) (BPK5059)
Plasmid#115137PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA2.1 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA2.1 anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hAcrVA3.1-NLS(sv40) (RTW2624)
Plasmid#115139PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA3.1 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA3.1 anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hAcrVA3-NLS(sv40) (BPK5077)
Plasmid#115140PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA3 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA3 anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hAcrVA2-NLS(sv40) (AAS2283)
Plasmid#115138PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA2 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA2 anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only