We narrowed to 15,447 results for: grn
-
Plasmid#68876PurposeCHD5 shRNA expressed from Adeno-associated viral (AAV) vectorDepositorInsertCHD5
UseAAV and RNAiExpressionMammalianPromoterH1Available sinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSMP-Ehmt1_3
Plasmid#36337DepositorAvailable sinceJune 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-cfRab11a_2
Plasmid#26710DepositorInsertdog Rab11a RNAi
UseLentiviral and RNAiExpressionMammalianMutationDog Rab11a RNAi.Available sinceDec. 15, 2010AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSuperRetro-puro-RalB 45i
Plasmid#11122DepositorPublicationAvailable sinceMay 25, 2006AvailabilityAcademic Institutions and Nonprofits only -
pIA123
Plasmid#234038PurposeE. coli-C. difficile shuttle vector for CRISPR editing in C. difficile. Pxyl::Cas9-opt Pgdh::sgRNA-cdr_0985. PstI site to add DNA for homology directed repair. MscI and NotI for replacement of sgRNA.DepositorInsertsCas9
sgRNA
UseCRISPRExpressionBacterialPromoterPgdh and PxylAvailable sinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pC178: pAAV.U6.SapI.CMV.Cas13bt3
Plasmid#204215PurposePlasmid AAV vector expressing Cas13bt3 and hU6-driven expression of guide RNAs. Contains SapI sites for guide cloning flanked by 5' and 3' full-length DRs.DepositorInsertCas13bt3 and U6.SapI sgRNA cloning site
UseAAV and CRISPRTagsHA and NLSExpressionMammalianMutationCodon optimisation by GenScript toolPromoterCMV/U6Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV CMV-DIO-(mCherry-U6)-shRNA(anti-Crh)
Plasmid#214732PurposeExpresses shRNA against CRH, marked with mCherry, in infected and cre positive cellsDepositorInsertanti-Crh shRNA / mCherry
UseAAVAvailable sinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-KLF7-1
Plasmid#169797PurposeExpresses Cas9 and guide RNA for the site neighbouring KLF7 gene.DepositorInsertguide RNA for KLF7 neighbouring region
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shHuR CDS
Plasmid#110411PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene, doxycycline inducible, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pFRT/TO/FLAGHA-SCAF8
Plasmid#122470PurposeDox-inducible FLAG/HA (N-terminal tag) SCAF8 expressionDepositorInsertSCAF8 isoform C CRISPR resistant (SCAF8 Human)
TagsFLAGHAExpressionMammalianMutationSynonymous mutations conferring resistance to gRN…PromoterCMVAvailable sinceMay 16, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAPM-D4 miR30-MPHOSPH8 ts2
Plasmid#115875PurposeMPHOSPH8 knockdownDepositorAvailable sinceJan. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEn-C1.1
Plasmid#61479PurposeEncodes CRISPR sgRNA for Gateway or conventional cloning of 1-3 sgRNAs into pDe-CAS9 or pCAS9-TPCDepositorInsertAtU6-26:sgRNA
UseCRISPRExpressionPlantPromoterU6-26Available sinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLIK-Venus-TmiR-G13-G12
Plasmid#25742PurposeLentiviral vector with Tet-based inducible expression of both mouse G alpha 12 and G alpha 13 miR30-based shRNAs, constitutive Venus fluorescent protein coexpression.DepositorInsertG alpha 13 and 12 miR-shRNA
UseLentiviral and RNAiTagsVenusExpressionMammalianAvailable sinceJuly 14, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLenti X2 Neo/pTER shLUC (w181-1)
Plasmid#17483Purpose3rd gen lentiviral Luciferase shRNA (H1/TO promoter), 3’LTR insertion, NeoDepositorPublicationInsertFirefly Luciferase shRNA
UseLentiviral and RNAiAvailable sinceAug. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
pSuperRetro mouse Hic-5
Plasmid#11187DepositorPublicationAvailable sinceFeb. 14, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAM/CBA-eGFP-miRaSyn(human)x3-WPRE-bGHpA
Plasmid#194247PurposeExpresses 3 miRNAs targeting human alpha-SynucleinDepositorAvailable sinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-HF-tetra-com-vector
Plasmid#132555PurposeVector plasmid expressing high fidelity spCas9 (R691A) and sgRNA scaffold with com replacing the Tetraloop.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsHigh fidelity Cas9
sgRNA scaffold with com replacing the Tetraloop
ExpressionMammalianAvailable sinceMarch 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV-EF1aGFP2AKAT7(E508Q)-W
Plasmid#159293PurposeLentiviral vector expressing GFP and KAT7 (gRNA-resistant, E508Q mutant) driven by human EF1a promoterDepositorInsertKAT7 E508Q
UseLentiviralExpressionMammalianMutationCRISPR sites mutated (gRNA ID. 5 and A10) and E50…Promoterhuman EF1a promoterAvailable sinceDec. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD051-sgMLH1-1
Plasmid#125776Purposeconstitutive expression of a guide RNA targeting human MLH1 (CRISPR cutting control) and S. pyogenes Cas9DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgMLH1-1 (MLH1 Human)
UseCRISPRAvailable sinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD051-sgMLH1-2
Plasmid#125777Purposeconstitutive expression of a guide RNA targeting human MLH1 (CRISPR cutting control) and S. pyogenes Cas9DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgMLH1-2 (MLH1 Human)
UseCRISPRAvailable sinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only