We narrowed to 25,293 results for: crispr
-
Plasmid#248530PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNA7-1
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA7-3
Plasmid#248531PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNA7-3
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA8-2
Plasmid#248532PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNA8-2
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
dpYPQ230-RRV-ABE
Plasmid#250716PurposedLbCas12a-RRV based adenine base editor, ecTadA8e fused to the N terminal of dLbCas12a-RRV with the linker of (GGGGS)x8DepositorInsertecTadA8e-(GGGGS)x8-dLbCas12a-RRV
UseCRISPRTags5' and 3' NLSExpressionPlantAvailable sinceApril 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTE_16 - pLenti_EFS-Cas9-BLM(1-193)-2A-BlastR
Plasmid#252012PurposeLentiviral mammalian expression of Cas9-BLM(2-194) TruEditorDepositorPublicationInsertCas9-BLM(2-194)
UseCRISPR and LentiviralMutationNAAvailable sinceMarch 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHS638_Flex-Cas12a-CBE
Plasmid#244845PurposeMammalian expression of Flex-Cas12a cytosine base editorDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertFlex-dCas12a-CBE
UseCRISPRTags2xSV40 NLS-APOBEC3A and Nucleoplasmid NLS-UGI-SV4…ExpressionMammalianMutationG146R/R182V/D535G/S551F/D665N/E795Q/D832APromoterCMVAvailable sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Kan-ADE2
Plasmid#232105PurposeExpresses galactose-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterGAL7Available sinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Nat-ADE2
Plasmid#232103PurposeExpresses galactose-inducible CRISPR guide RNA and repair template for creating a frameshift mutation in ADE2 gene of yeast.DepositorInsertADE2 gRNA and repair template
UseCRISPRExpressionYeastMutationRepair template introduces C at nt 466 of ADE2 to…PromoterGAL7Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-GAL-Hyg
Plasmid#232098PurposeYeast CEN plasmid for galactose-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with HygMX selectionDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCK668
Plasmid#192637PurposeExpresses dCas9-NG and MCP-SoxS(R93A/S101A) on p15A-CmRDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsSp.pCas9-dCas9-NG
BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPR and Synthetic BiologyMutationSoxS has R93A and S101A mutations and dCas9-NG ha…PromoterBBa_J23107 and Sp.pCas9Available sinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorPublicationInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSIBR005
Plasmid#177668PurposeConstitutive expression of FnCas12aDepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterlacUV5Available sinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEC578
Plasmid#174366PurposedCas9 for modular CRISPRa. SYNZIP-dCas9. Expresses dCas9 with a SYNZIP18 domain fused to the N terminus.DepositorInsertdCas9 fused to SYNZIP18
ExpressionBacterialPromoterJ23150Available sinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRU205
Plasmid#167685PurposeFinal destination vector for single Gateway LR reactionDepositorInsertPcUBQ4-2::asCpf1
UseCRISPRAvailable sinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRU321
Plasmid#167681PurposeFinal destination vector for single Gateway LR reactionDepositorInsertPcUB4-2::asCas9
UseCRISPRAvailable sinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRU320
Plasmid#167682PurposeFinal destination vector for single Gateway LR reactionDepositorInsertPcUBQ4-2::asCas9
UseCRISPRAvailable sinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-P1-N-EGFP-C
Plasmid#159436PurposeCRISPR knock-in donor construct with fluorescent reporterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertEGFP
UseCRISPRTags3' linker pair 1, 5' linker pair 1, C t…PromoterCMVAvailable sinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
PV225
Plasmid#132334PurposedCas9 plant transcriptional activator (AT-CBF1) linked constitutive expression cassette for Zea maysDepositorInsertdCas9-AT-CBF1 (CBF1 Cas9 (Streptococcus pyogenes); AT-CBF1 (Arabidopsis thaliana))
TagsAT-CBF1ExpressionPlantMutationCodon optimize for expression and stability in Ze…Available sinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEPOR0SP0011
Plasmid#117530PurposeLevel0 Golden Gate part: CDS, Sp-xCas9 3.7 (no stop codon)DepositorInsertSp-xCas9 3.7 (no stop codon)
UseCRISPRMutationA262T, R324L, S409I, E480K, E543D, M694I, E1219VAvailable sinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-TdT-guide1-PGK-Puro
Plasmid#102903PurposeEBNA episome plasmid for U6 promoter-driven expression of a control gRNA targeting TdTomato sequence. Includes PGK-puro selection cassette.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTdT-guide1-PGK-Puro
UseCRISPRExpressionMammalianPromoterU6Available sinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by