We narrowed to 1,444 results for: aav vector plasmid
-
Plasmid#130991PurposeAAV vector to drive the expression of soma-targeted ChRmine-mScarlet under the control of CamKIIa promoterDepositorHas ServiceAAV8InsertChRmine
UseAAVTagsmScarlet-Kv2.1ExpressionMutationPromoterCaMKIIaAvailable sinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-ChroME2s-ST-P2A-NLS-mRuby3
Plasmid#170177PurposeCation channelrhodopsin ChroME2s targeted to the neuronal soma and proximal dendrites and separated from nuclear mRuby3 by P2A in a viral vectorDepositorInsertChroME2s-ST-P2A-NLS-mRuby3
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-ChroME2f-ST-P2A-NLS-mRuby3
Plasmid#170175PurposeCation channelrhodopsin ChroME2f targeted to the neuronal soma and proximal dendrites and separated from nuclear mRuby3 by P2A in a viral vectorDepositorInsertChroME2f-ST-P2A-NLS-mRuby3
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-FAS-NES-jRGECO1a-WPRE
Plasmid#141236PurposeAAV vector with Ef1a promoter and LoxFAS sites for Cre-Off expression of jRGECO1a (jRGECO1a will not be expressed in mammalian cells that express Cre recombinase)DepositorInsertNES-jRGECO1a
UseAAV and Cre/Lox; Cre-offTags6xHIS tag and nuclear export signalExpressionMutationPromoterhuman elongation factor-1 alpha (EF-1 alpha)Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ChRmine-eYFP-Kv2.1-WPRE
Plasmid#130993PurposeAAV vector to drive the expression of soma-targeted ChRmine-eYFP under the control of human synapsin promoterDepositorInsertChRmine
UseAAVTagsEYFP-Kv2.1ExpressionMutationPromoterhSynAvailable sinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-ChRmine-eYFP-Kv2.1-WPRE
Plasmid#130989PurposeAAV vector to drive the expression of soma-targeted ChRmine-eYFP under the control of CamKIIa promoterDepositorInsertChRmine
UseAAVTagsEYFP-Kv2.1ExpressionMutationPromoterCaMKIIaAvailable sinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC809 - pAAV-EF1a-CRTsigpep-GCaMP3-KDEL
Plasmid#63884PurposeAn AAV packaging vector that expresses ER-retained GCaMP3 under control of the EF1a promoter.DepositorInsertER-localized GCaMP3(wt)
UseAAVTagsExpressionMutationPromoterEF1aAvailable sinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EWB-DIO-cyan pre-eGRASP(p30)
Plasmid#111583PurposeAn AAV vector that expresses double floxed cyan pre-eGRASP(p30) under the Ef1a promoter.DepositorInsertcyan pre-eGRASP(p30)
UseAAVTagsExpressionMutationPromoterEf1aAvailable sinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EWB-DIO-cyan pre-eGRASP(p32)
Plasmid#111589PurposeAn AAV vector that expresses double floxed cyan pre-eGRASP(p32) under the Ef1a promoter.DepositorInsertcyan pre-eGRASP(p32)
UseAAVTagsExpressionMutationPromoterEf1aAvailable sinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pM125: pAAV-EFS-CasRx-VEGFA array presgRNA
Plasmid#166873PurposeAAV vector for expressing CasRx and human VEGFA targeting presgRNA array for RNA-editingDepositorInsertsU6-VEGFA array presgRNA
RfxCas13d
UseAAV and CRISPRTagsHA and NLSExpressionMammalianMutationPromoterEFS and U6Available sinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-H2B-GFP-2A-oG-WPRE-hGH
Plasmid#74289PurposepAAV vector to express H2B-GFP and oG (optimized Glycoprotein) in a Cre-dependent mannerDepositorInsertH2B-GFP and oG (optimized Glycoprotein)
UseAAVTagsExpressionMammalianMutationchimeric glycoproteinPromoterEf1aAvailable sinceApril 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA
Plasmid#61591PurposeA single vector AAV-Cas9 system containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA.DepositorInsertshSaCas9
Chimeric guide for SaCas9
UseAAV and CRISPRTags3xHA and NLSExpressionMammalianMutationPromoterAvailable sinceFeb. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Flex-mRuby2-GSG-P2A-GCaMP6f-WPRE-pA
Plasmid#68719PurposeCre-dependent bicistronic vector expressing mRuby2 and GCaMP6f from a single open reading frame.DepositorHas ServiceAAV1InsertmRuby2-P2A-GCaMP6f
UseAAVTagsExpressionMutationPromoterCAG-FLEXAvailable sinceJune 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EWB-DIO-myriRFP670V5-P2A-post-eGRASP
Plasmid#111585PurposeAn AAV vector that expresses double floxed myristoylated iRFP670 with V5 tag and post-eGRASP linked by self-cleaving P2A peptide under the Ef1a promoter.DepositorInsertmyriRFP670V5-P2A-post-eGRASP
UseAAVTagsExpressionMutationPromoterEf1aAvailable sinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CK(0.4)-CRY2PHR-P2A-CIBN-mCherry-VAMP2
Plasmid#178576PurposeAAV vector for CK(0.4)::Opto-vTrapDepositorInsertCRY2PHR-P2A-CIBN-mCherry-VAMP2
UseAAVTagsExpressionMutationPromoterCamKIIaAvailable sinceApril 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EWB-DIO-myrTagRFP-T-P2A-post-eGRASP
Plasmid#111581PurposeAn AAV vector that expresses double floxed myristoylated TagRFP-T and post-eGRASP linked by self-cleaving P2A peptide under the Ef1a promoter.DepositorInsertmyrTagRFP-T-P2A-post-eGRASP
UseAAVTagsExpressionMutationPromoterEf1aAvailable sinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-EGFP-P2A-EGFPf-WPRE-HGHpA
Plasmid#74513PurposeAAV vector that use human synapsin-1 promoter to drive the expression of EGFP and membrane-targeted EGFPf linked by self-cleaving P2A peptide.DepositorInsertEGFP-p2A-EGFP-f
UseAAVTagsExpressionMutationPromoterAvailable sinceJuly 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (Hbb Synthetic)
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-ChroME-ST-P2A-H2B-mRuby3
Plasmid#108912PurposeCation channelrhodopsin ChroME targeted to the neuronal soma and proximal dendrites and separated from nuclear mRuby3 by P2A in a viral vectorDepositorHas ServiceAAV9InsertChroME-ST
UseAAVTagsExpressionMutationPromoterCAGAvailable sinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2ExpressionMutationPromoterEF1a, hU6, and mU6Available sinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only