We narrowed to 15,447 results for: grn
-
Plasmid#173598PurposeExpresses a Kmt2d-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Kmt2d (Kmt2d Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330_ATP1A1_G7
Plasmid#173204PurposeExpresses the ATP1A1 G7 sgRNA in combination with SpCas9 to target ATP1A1 intron 17.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertATP1A1 G7 sgRNA + SpCas9
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable sinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
px459-AMBRA1 #3
Plasmid#172606PurposeExpresses gRNA #3 against AMBRA1 and Cas9 from S. pyogenes with 2A-PuroDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA against AMBRA1 (AMBRA1 Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL3-2
Plasmid#109010PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable sinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgC1orf27-1
Plasmid#86130PurposeLentiviral vector expressing Cas9 and an sgRNA targeting C1orf27DepositorInsertsgRNA 1 targeting C1orf27 (C1orf27 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_FOXP1_2
Plasmid#86300PurposeEncodes gRNA for 3' target of human FOXP1DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA against FOXP1 (FOXP1 Human)
UseCRISPRAvailable sinceJan. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_TFE3_2
Plasmid#86326PurposeEncodes gRNA for 3' target of human TFE3DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA against TFE3 (TFE3 Human)
UseCRISPRAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAGK111
Plasmid#228126PurposeExpress node 1531 retron with split retron ncRNA and gRNA to edit (SNIP + PAM recode) EMX1 gene in human cellsDepositorInsertRetron node 1531 split retron ncRNA and gRNA to edit EMX1 gene (SNP + PAM recode) in human cells
ExpressionMammalianPromoterCAG for RT, U6/H1 for ncRNA/gRNAAvailable sinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-TJP1
Plasmid#227299PurposeExpresses SpCas9 and a sgRNA targeting the N-terminus of TJP1 for knock-in.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA Targeting N-terminus of TJP1 (TJP1 Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpyB-GFP
Plasmid#220190PurposesgRNA expression vector - pBG35 promoter with GFP in sgRNA siteDepositorInsertpBG35 promoter with GFP in sgRNA site
UseCRISPRExpressionBacterialMutationmonomeric superfolder green fluorescent proteinPromoterpBG35Available sinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpyC-GFP
Plasmid#220191PurposesgRNA expression vector - pBG42 promoter with GFP in sgRNA siteDepositorInsertpBG42 promoter with GFP in sgRNA site
UseCRISPRExpressionBacterialMutationmonomeric superfolder green fluorescent proteinPromoterpBG42Available sinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX459v3-eSpCas9(1.1)
Plasmid#178800PurposeHigh-fidelity eSpCas9(1.1) with 2A-Puro, and a golden gate cloning backbone for sgRNA. sgRNA scaffold seqeuence has been modified for increased sgRNA expression (v3).DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCbh (Cas9-2A Puro) and U6 (gRNA)Available sinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX459v3-SpCas9-HF1
Plasmid#178801PurposeHigh-fidelity SpCas9-HF1 with 2A-Puro, and a golden gate cloning backbone for sgRNA. sgRNA scaffold seqeuence has been modified for increased sgRNA expression (v3).DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCbh (Cas9-2A Puro) and U6 (gRNA)Available sinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
SaCas9v2-Puro
Plasmid#178802PurposeSaCas9 with 2A-Puro, and a cloning backbone for sgRNA.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCbh (Cas9-2A Puro) and U6 (gRNA)Available sinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgKcnd3
Plasmid#159912PurposeMutagenesis of Kcnd3DepositorInsertKcnd3 (Kcnd3 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable sinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSB700-mouse-ACTC1-Puro
Plasmid#128326PurposeSP-dCas9 compatible gRNA to be used as a positive control for activation experiments (mouse cells)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA against mouse ACTC1 for activation (Actc1 Mouse)
ExpressionMammalianAvailable sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-