We narrowed to 15,169 results for: GRN
-
Plasmid#205964PurposeNZ_CP025815 DinG HNH crRNA expression in pCOLADuet-1DepositorInsertDinG HNH crRNA
ExpressionBacterialPromoterT7Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0KN0750
Plasmid#185627PurposeModified tobacco rattle virus RNA2 acceptor vector that could be used for expression of sgRNAs, contains restriction enzyme sites for golden gate assembly using AarIDepositorInsertlacZ
UseCRISPR and Synthetic BiologyAvailable SinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPv2_FDX1-2
Plasmid#184489PurposeLentivirus all in one CRISPR vector targeting human FDX1 geneDepositorInsertFDX1 (FDX1 Human)
UseLentiviralAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-STAU1-3'UTR
Plasmid#136049PurposeSTAU1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CCATCACCACTGCTTTCTCTT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ-DoxOn-shCUX1-5150
Plasmid#90469PurposeLentiviral vector expressing a doxycycline-inducible shRNA against human CUX1 sequence starting at 5150 of M74099DepositorInsertTGCTGTTGACAGTGAGCGTCAGAGCGATAATACACTATTATAGTGAAGCC
UseLentiviral and RNAiExpressionMammalianAvailable SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330-H11r1-2-DD-Cas9
Plasmid#85978PurposeExpresses DD-SpCas9 in mammalian cells and targets the H11 locus in human cellsDepositorInsertDD-SpCas9
UseCRISPRTagsFKBP12 L106P DDExpressionMammalianAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_26G
Plasmid#91149PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:TaCas9_dead + TaU6:gRNA , Plant Selection: PvUbi2:barDepositorInsertEngineering Reagent: ZmUbi:TaCas9_dead + TaU6:gRNA
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_21B
Plasmid#91129PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:AtCas9_dead + AtU6:gRNA, Plant Selection: 2x35S:hpt IIDepositorInsertEngineering Reagent: 35S:AtCas9_dead + AtU6:gRNA
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
Banshee-Sh-Ctrl
Plasmid#85587PurposeControl hairpin sequence used in gene knockdown experiementsDepositorInsertsh-Ctrl
UseRetroviralExpressionMammalianPromoterH1Available SinceFeb. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
ZO-2 shRNA 2434
Plasmid#37211DepositorAvailable SinceAug. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
ZO-2 shRNA 1320
Plasmid#37210DepositorAvailable SinceAug. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pENTR APLP1 shRNA 2
Plasmid#30157DepositorInsertAPLP1 shRNA 2
ExpressionMammalianAvailable SinceJuly 28, 2011AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT22
Plasmid#223394PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for monocot plants; NG or NA PAM ; wide working window; A3A/Y130F-CBE_V01 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter.DepositorInsertZmUbi-hA3A-Y130F-SpRYD10A-UGI-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT39
Plasmid#223411PurposeT-DNA vector for SpRY-D10A based A-to-G base editing for dicot plants; NA or NG PAM preference; SpRYD10A-ABE was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants select.DepositorInsert2x35s-ecTadA8e-SpRY-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT19
Plasmid#223391PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for dicot plants; NG or NA PAM ; wide working window; A3A/Y130F-CBE_V01 was driven by AtUBQ10 and the sgRNA was driven by AtU3 promoter.DepositorInsertAtUBQ10-hA3A-Y130F-SpRYD10A-UGI-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT13
Plasmid#223385PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for dicot plants; NGG PAM; wide working window; A3A/Y130F-CBE_V01 was driven by AtUBQ10 and the sgRNA was driven by AtU3 promoter.DepositorInsertAtUBQ10-hA3A-Y130F-SpCas9-D10A-UGI-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
PDG458 eSp(1.1) V3
Plasmid#226964PurposeCBh-eSpCas9(1.1)-2A-GFP, and 2X hU6-sgRNA (Sp) with BbsI golden gate cloning backbone dual gRNAs. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
CIRTS-control
Plasmid#213788PurposeCIRTS RNA targeting system for targeted knockdown in neurons. CIRTS-Calm3 and scramble control guide RNA is expressed under human Syn1 and U6 promoter, respectively.DepositorInsertCIRTS-Calm3-U6-control gRNA
UseLentiviralTagsGFPExpressionMammalianPromoterSyn1, U6Available SinceFeb. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVX-H3.3-G34R-FLAG-BFP
Plasmid#209440PurposeLentiviral packagable plasmid expressing FLAGGED human histone mutant H3.3-G34R with BFPDepositorInsertH3.3-G34R
ExpressionMammalianMutationG34RAvailable SinceNov. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRDA_122
Plasmid#208095PurposePerturb-Seq lentiviral gRNA expression vector with a 3' appended capture sequence to enable direct capture of CRISPR gRNAs for scRNA-seqDepositorInsertPuromycin resistance
UseCRISPR and LentiviralPromoterEF1aAvailable SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only