We narrowed to 43,328 results for: ANT
-
Plasmid#138121PurposeGateway entry plasmid (attL1 & attR5) expressing rice codon optimized Lb5Cas12a with N512R, K518V and N522R mutations, without promoterDepositorInsertLb5Cas12a RVR variant
UseCRISPR; Gateway compatible cas12a entry cloneTagsNLSExpressionPlantMutationN512R, K518V and N522RAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 tRNA-gRNA E4-En-1 (GB2243)
Plasmid#160565PurposetRNA and scaffold for the assembly of GBoligomers for the position [4_(n-1)] of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInserttRNA-gRNA position E4-En-1 (Multiplexing Edit)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPGK-T7/2-CD44v2-10 (-cyt)
Plasmid#137825Purposeexpression of CD44 proteins in mammalian cellsDepositorInsertCD44v2-10 (-cyt) (CD44 Human)
TagsGFPExpressionMammalianMutationwithout cytoplasmic region - N213S on the CD44 re…PromoterPGKAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-FLAG-TAPBPR-TM-VC
Plasmid#135499PurposeMammalian expression of VC-fused and FLAG-tagged TAPBPR with MHC TMDepositorInsertTAPBPR (TAPBPL Human)
TagsLuminal/Extracellular FLAG epitope tag, Signal pe…ExpressionMammalianMutationswitched transmembrane domain with that of MHC-IPromoterCMVAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMVenh synapsin-intron-aSYNUCLEIN A53T
Plasmid#227004PurposeAAV transfer plasmid encoding the human A53T mutant α-SYN under the control of the CMVie enhanced synapsin1 promoterDepositorInsertalpha synuclein A53T mutant (SNCA Human, Synthetic)
UseAAVMutationA53TPromoterCMVenh synapsinAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRRL_SRSF2_WT_mCherry
Plasmid#84020Purposeexpression of SRSF2 in mammalian cellsDepositorInsertSRSF2 (SRSF2 Human)
UseLentiviralTags2TA-mCherry and FlagExpressionMammalianPromoterPGKAvailable SinceOct. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV x EF1a_EKAREN5-ires-puro
Plasmid#167821PurposeOptimized EKAREV FRET biosensor sensor for ERKDepositorInsertEKAREN5
UseLentiviralTagsnls localization motifExpressionMammalianMutationK424P, K426WPromoterEF1aAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FRT-Rev-TdTomato
Plasmid#191203PurposeFlpO dependent TdTomato expressionDepositorInsertTdTomato
UseAAVExpressionMammalianPromoterCAGAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-TP1107(Q15TAG)
Plasmid#247462PurposeBacterial expression of anti-IgG VHH clone TP1107 with amber stop codon at Q15 for unnatural amino acid incorporationDepositorInsertTP1107 Q15TAG
TagsHis6 and TEV protease cleavage siteExpressionBacterialMutationOriginal Q15 codon (CAA) was modified to amber st…PromoterT7Available SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FRT-Rev-3xGFP
Plasmid#191204PurposeFlpO dependent GFP expressionDepositorInsert3X GFP
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
A24M04 Ig kappa light chain-pFEEKW
Plasmid#234810PurposeExpress Ig kappa light chain containing the VL region of the monoclonal antibody, A24M04, specific for human papilloma virus16 L1DepositorUseLentiviralExpressionBacterial and MammalianPromoterEEK promoterAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-YFP-KRAS4B
Plasmid#112718PurposeExpresses YFP-KRAS4B fusion protein used for FRET studies in eukaryotic cells.DepositorInsertYFP-KRAS4B (KRAS Human)
ExpressionMammalianAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
Venus1-WTSTAT3
Plasmid#123164PurposeExpresses wild type STAT3 fused to the 1-157 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus1 (aa 1-157) (STAT3 Human)
TagsVenus1 (aa 1-158) for bimolecular fluorescence co…ExpressionMammalianMutationnonePromoterpCMVAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_U6 tRNAPyl_CMV NESPylRS(AF)_IRES_eRF1(E55D)-HA
Plasmid#182653PurposeEncodes codon-optimized AF mutant of M. mazei pyrrolysine (Pyl) tRNA synthetase fused to a nuclear export signal (NESPylRSAF),tRNACUAPyl & eRF1E55D used for amber codon suppression in mammalian cellsDepositorInsertscodon-optimized Y306A/Y384F (AF) double mutant of Methanosarcina mazei-derived pyrrolysine (Pyl) tRNA synthetase
PylT
mutant eukaryotic release factor 1
TagsHA tag and nuclear export signal (NES)ExpressionMammalianMutationE55D and Y306A/Y384F (AF) double mutant of Methan…PromoterCMV and U6Available SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV x EF1a_EKAREN5(TA)-ires-puro
Plasmid#167823Purposecontrol sensor for EKAREN5DepositorInsertEKAREN5(TA)
UseLentiviralTagsnls localization motifExpressionMammalianMutationK424P, K426W, T420APromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
LgBiT-hACE2
Plasmid#173431Purposeprotein expression plasmid of LgBiT-hACE2-IgG1 FcDepositorAvailable SinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
CCR6-DuET
Plasmid#213202PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV x EF1a_EKAREN4-ires-puro
Plasmid#167828PurposeOptimized EKAREV FRET biosensor sensor for ERKDepositorInsertEKAREN4
UseLentiviralTagsnls localization motifExpressionMammalianMutationK424P, K426WPromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only