We narrowed to 9,815 results for: CAG
-
Plasmid#115518PurposeDonor vector for FLPe recombinase-mediated cassette exchange in master cell lines created with plasmid #112666. This vector allows OCT4 dependent expression of GFP, and contains cHS4 insulators.DepositorInserteGFP
UseAAV; Donor plasmid for recombinase-mediated casse…ExpressionMammalianAvailable SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPten#2/Cre
Plasmid#173646PurposeExpresses a Pten-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Pten (Pten Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 mTagBFP2 rat PGK1 shRNA
Plasmid#222869PurposeExpresses mTagBFP2 along with an shRNA against rat PGK1DepositorAvailable SinceJuly 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1-sgPHGDH-G5
Plasmid#83913Purposestable knockoutDepositorInsertPhosphoglycerate dehydrogenase (PHGDH Human)
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceOct. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOTTC763 - pX458 with rat Rosa26 gRNA A
Plasmid#113161PurposeA plasmid that expresses a guide RNA targeting rat Rosa26 as well as FLAG-tagged SpCas9 and GFPDepositorInsertgRNA for rat Rosa26
UseCRISPRExpressionMammalianPromoterhU6Available SinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTp53#2/Cre
Plasmid#173621PurposeExpresses a Tp53-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Tp53 (Trp53 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-H2B-mCherry (dual gRNA: Neurog2 x2)
Plasmid#171100PurposeCRISPR/Cas9 expressing plasmid containing two gRNAs targeting mouse Neurog2.DepositorAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPten#1/Cre
Plasmid#173645PurposeExpresses a Pten-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Pten (Pten Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-46: MYL7-mEGFP
Plasmid#114413PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human MYL7, via Cas9-excisable CAGGS-mCherry selection cassetteDepositorInsertMYL7 Homology Arms with linker-mEGFP and Cas9-excisable selection cassette (MYL7 Human)
UseCRISPR; Donor templateTagslinker-mEGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
sgTP53(R273)
Plasmid#85561PurposeExpresses sgRNA targeting human TP53 around codon R273DepositorInserttumor protein p53 (TP53 Human)
ExpressionMammalianAvailable SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SMARCA2(47))-PGKpuro2ABFP-W
Plasmid#200510PurposeLentiviral vector expressing gRNA targeting human SMARCA2DepositorInsertSMARCA2(47) (SMARCA2 Human)
UseLentiviralAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pXPR003-sgTP53-2
Plasmid#118020PurposeConstitutive expression of sgRNA targeting human TP53DepositorAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATM gRNA (BRDN0001146099)
Plasmid#77530Purpose3rd generation lentiviral gRNA plasmid targeting human ATMDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAPK1 gRNA (BRDN0001149093)
Plasmid#77788Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SMARCA4(43))-PGKpuro2ABFP-W
Plasmid#200464PurposeLentiviral vector expressing gRNA targeting human SMARCA4DepositorInsertSMARCA4(43) (SMARCA4 Human)
UseLentiviralAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-CACNA1E KI
Plasmid#131481PurposeEndogenous tagging of CaV2.3, R: N-terminal (amino acid position: G5)DepositorAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
MAPK1 gRNA (BRDN0001147355)
Plasmid#77787Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only