We narrowed to 982 results for: lentiviral vector plasmid
-
Plasmid#121794PurposepMVP L3-L2 entry plasmid, contains AID + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows fusion of minimal C-term AID domain (activated by auxin) to gene in lentivirus vectorsDepositorInsertAID + WPRE
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
JD602: pMVP (L3-L2) APEX2 + WPRE
Plasmid#121798PurposepMVP L3-L2 entry plasmid, contains APEX2 + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows fusion of C-term APEX2 to gene of interest in lentivirus vectors.DepositorInsertAPEX2 + WPRE
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LC801: pMVP (L3-L2) eGFP + WPRE
Plasmid#121771PurposepMVP L3-L2 entry plasmid, contains eGFP + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term eGFP fusion to gene of interest in lentivirus vectors.DepositorInserteGFP + WPRE
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LC901: pMVP (L3-L2) mCherry + WPRE
Plasmid#121773PurposepMVP L3-L2 entry plasmid, contains mCherry + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term mCherry fusion to gene of interest in lentivirus vectors.DepositorInsertmCherry + WPRE
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LD001: pMVP (L3-L2) eYFP + WPRE
Plasmid#121777PurposepMVP L3-L2 entry plasmid, contains eYFP + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term eYFP fusion to gene of interest in lentivirus vectors.DepositorInserteYFP + WPRE
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KZ901: pMVP (L3-L2) P2A-eGFP + WPRE
Plasmid#121772PurposepMVP L3-L2 entry plasmid, contains eGFP-P2A + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term eGFP linked by P2A to gene of interest in lentivirus vectors.DepositorInsertP2A-eGFP + WPRE
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LA601: pMVP (L3-L2) P2A-Puro + WPRE
Plasmid#121785PurposepMVP L3-L2 entry plasmid, contains Puro-P2A + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Puro selection marker linked by P2A to a gene in lentivirus vectorsDepositorInsertP2A-Puro + WPRE
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LA001: pMVP (L3-L2) P2A-mCherry + WPRE
Plasmid#121774PurposepMVP L3-L2 entry plasmid, contains mCherry-P2A + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term mCherry linked by P2A to gene of interest in lentivirus vectors.DepositorInsertP2A-mCherry + WPRE
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LA102: pMVP (L3-L2) P2A-eYFP + WPRE
Plasmid#121778PurposepMVP L3-L2 entry plasmid, contains eYFP-P2A + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term eYFP linked by P2A to gene of interest in lentivirus vectors.DepositorInsertP2A-eYFP + WPRE
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LA301: pMVP (L3-L2) P2A-Hygro + WPRE
Plasmid#121787PurposepMVP L3-L2 entry plasmid, contains Hygro-P2A + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Hygro selection marker linked by P2A to gene in lentivirus vectorsDepositorInsertP2A-Hygro + WPRE
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LA401: pMVP (L3-L2) P2A-Blast + WPRE
Plasmid#121784PurposepMVP L3-L2 entry plasmid, contains Blast-P2A + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Blast selection marker linked by P2A to gene in lentivirus vectorsDepositorInsertP2A-Blast + WPRE
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LA501: pMVP (L3-L2) P2A-Neo + WPRE
Plasmid#121786PurposepMVP L3-L2 entry plasmid, contains Neo-P2A + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Neo selection marker linked by P2A to a gene in lentivirus vectorsDepositorInsertP2A-Neo + WPRE
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LA701: pMVP (L3-L2) P2A-Zeo + WPRE
Plasmid#121788PurposepMVP L3-L2 entry plasmid, contains Zeo-P2A + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Zeo selection marker linked by P2A to a gene in lentivirus vectors.DepositorInsertP2A-Zeo + WPRE
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pgRNA-CKB
Plasmid#73501PurposegRNA expression vector (with mKate2)DepositorInsertmKate2-T2A-Bsd
UseCRISPR and LentiviralTagsNLSExpressionMammalianPromoterCAGAvailable SinceDec. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNluc-sgControl
Plasmid#208383PurposeThis sgControl, located in the TP53BP1 intron, serves as a control sgRNA for the others. The vector was cloned from Lenti-sgRNA-Cre-GpNLuc.DepositorInsertsgControl (TP53BP1 intron) (Trp53bp1 Mouse)
UseLentiviral and LuciferaseExpressionMammalianMutationWTAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-Snrnp40
Plasmid#134255PurposeLentivector for Snrnp40 CRISPR knockoutDepositorInsertSnrp40 (Snrnp40 Mouse)
UseCRISPR and LentiviralMutationSnrnp40 gRNA “GATAACTATGCGACGTTGAA”PromoterU6Available SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1A-CD19.8H.8TM.28.BB.3z
Plasmid#200672PurposeModular CD8hinge-CD8transmembrane-CD28-41BB-CD3z CAR backbone, For Transient Expression or Lentiviral ProductionDepositorUseLentiviralTagsMycTagExpressionMammalianPromoterEF1a-shortAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1A-CD19.8H.8TM.BB.28.3z
Plasmid#200673PurposeModular CD8hinge-CD8transmembrane-41BB-CD28-CD3z CAR backbone, For Transient Expression or Lentiviral ProductionDepositorUseLentiviralTagsMycTagExpressionMammalianPromoterEF1a-shortAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1A-CD19.8H.28TM.28.BB.3z
Plasmid#200676PurposeModular CD8hinge-CD28transmembrane-CD28-41BB-CD3z CAR backbone, For Transient Expression or Lentiviral ProductionDepositorUseLentiviralTagsMycTagExpressionMammalianPromoterEF1a-shortAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1A-CD19.8H.28TM.BB.28.3z
Plasmid#200677PurposeModular CD8hinge-CD28transmembrane-41BB-CD28-CD3z CAR backbone, For Transient Expression or Lentiviral ProductionDepositorUseLentiviralTagsMycTagExpressionMammalianPromoterEF1a-shortAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only