We narrowed to 12,660 results for: nsf
-
Plasmid#208725PurposeExpresses the red 5-HT sensor GRAB_r5-HT1.0 in neurons in the presence of Cre recombinaseDepositorInsertRed fluorescent 5-HT sensor GRAB_r5-HT1.0
UseAAVPromoterEF1aAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-CAG-iGABASnFR2n-WPRE
Plasmid#218884PurposeAAV-mediated expression of improved GABA sensor (negative change in fluorescence)DepositorInsertiGABASnFR2n
UseAAVExpressionMammalianMutationS99A F104H R168PPromoterCAGAvailable SinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
BMR1_01g02031-bio-His
Plasmid#108116Purpose[Edit] Expresses enzymatically monobiotinylated full-length BMR1_01g02031 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tagDepositorInsertBMR1_01g02031
TagsratCD4d3+4,biotinylation sequence, 6xHisExpressionMammalianMutationall potential N-linked glycosylation sites (N-X-S…PromoterCMVAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENN.AAV.CB7.CI.ACY1-flag.WPRE.rBG
Plasmid#132686PurposeAAV plasmid encoding mouse ACY1 with C-terminal flag tagDepositorAvailable SinceNov. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV CAG ChR2 E123T T159C 2A tDimer
Plasmid#85399PurposeHigh efficiency channelrhodopsin with cytomegalovirus enhancer fused to chicken β-actin (CAG) promoterDepositorInsertsChannelrhodopsin-2
red fluorescent protein
UseAAVExpressionMammalianMutationE123T , T159CPromoterCAG and ribosomal skip sequence 2AAvailable SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO hChR2(E123A)-mCherry
Plasmid#35508PurposeAAV expression of EF1a-driven, cre-dependent, hChR2 variant CheTA 2.0 for ultrafast optogenetic control.DepositorInserthChR2
UseAAVTagsmCherryExpressionMammalianMutationE123APromoterEf1aAvailable SinceApril 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-dLight1.2
Plasmid#111069PurposeTo generate Adeno-Associated viruses for expression of dLight1.1 under CAG promoterDepositorHas ServiceAAV1InsertdLight1.2
UseAAVTagsFlag tagAvailable SinceJuly 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS2
Plasmid#170853PurposeAAV backbone for Cre-dependent transgene expression of any transgene in neurons under the control of the hSyn1 promoter.DepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-dCas9-MQ1(C141S)-EGFP
Plasmid#89635PurposeTargeted CpG methylationDepositorInsertsite-specific DNA-methyltransferase SssI
UseCRISPRTags3*FLAG, 6*His, and T2A-EGFPExpressionMammalianMutationC141S, TGC-->TCCPromoterCMVAvailable SinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAC147-pCR8-dCas9VP64
Plasmid#48219PurposedCas9VP64 on Gateway donor vector pCR8/GW/TOPO. Note: This is not for expression. It has to be transferred to a gateway destination vector for expressionDepositorInsertdCas9(D10A;H840A) fusion with VP64 activation domain
UseCRISPR; Gateway donorTagsHA Tag and VP64MutationD10A;H840AAvailable SinceSept. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.Flex.iGluSnFr.WPRE.SV40
Plasmid#98932PurposeCre dependent AAV expression of glutamate sensor from GFAP promoter ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorHas ServiceAAV1, AAV5, and AAV9InsertiGluSnFr
UseAAVExpressionMammalianPromoterCAGAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-FAS-NES-jRGECO1a-WPRE
Plasmid#141236PurposeAAV vector with Ef1a promoter and LoxFAS sites for Cre-Off expression of jRGECO1a (jRGECO1a will not be expressed in mammalian cells that express Cre recombinase)DepositorInsertNES-jRGECO1a
UseAAV and Cre/Lox; Cre-offTags6xHIS tag and nuclear export signalPromoterhuman elongation factor-1 alpha (EF-1 alpha)Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a-baPrs-hdNadV
Plasmid#91950PurposepET28a-baPrs-hdNadV is a bicistronic vector designed for the simultaneous expression of PRS from Bacillus amyloliquefaciens and NadV from Haemophilus ducreyiDepositorInsertsPutative Nicotinamide Phosphoribosyl Transferase (nadV Haemophilus ducreyi, strain: ATCC 27722)
Phosphoribosyl Pyrophosphate Synthetases
ExpressionBacterialMutationchanged Leucine 135 to IsoleucinePromoterT7Available SinceSept. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-tdTomato-f
Plasmid#127092PurposeAn AAV genome with tet-inducible, Cre-dependent expression of farnesylated (f) tdTomatoDepositorInserttdTomato-f
UseAAVTagsfarnesylation signal from c-Ha-RasExpressionMammalianAvailable SinceJune 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
MSP10-bio
Plasmid#47719PurposeExpresses enzymatically monobiotinylated full-length MSP10 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised MSP10
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
FUG-T2A-Cas9
Plasmid#75346PurposeUbiquitin promoter expresses GFP and humanized spCas9 (from PX330) via a T2A motif. For cell transfection or use in lentiviral packaging. Use Pac1 and/or BstB1 sites to insert sgRNAs from PXL.DepositorInsertCas9
UseCRISPR and LentiviralTagsGFP (via t2a)ExpressionMammalianPromoterUbiquitinAvailable SinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV CMV-driven AcrIIA4-2xmiR-122 target sites
Plasmid#120298PurposeAAV vector for expression of AcrIIA4 with two miR-122 binding sitesDepositorInsertAcrIIA4-2xmiR-122 binding sites
UseAAV and CRISPRTagsFLAGExpressionMammalianAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-Mac-GFP
Plasmid#58852PurposeAAV-mediated expression of Mac-GFP under the Syn promoter, in floxed/reversed (Cre-dependent) mannerDepositorInsertMac-GFP
UseAAV and Cre/LoxTagsGFPExpressionMammalianPromoterSynAvailable SinceAug. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV-SYN_mMaroon-KIX-mMaroon
Plasmid#137009PurposeAAV backbone, mMaroon-KIX acceptor for R-CREBDepositorAvailable SinceJuly 16, 2020AvailabilityAcademic Institutions and Nonprofits only