We narrowed to 31,103 results for: CHI;
-
Plasmid#246293PurposeEvaluation of CiU6.1 promoter (Pol III promoter) for CRISPR-Cas9 editing of mEGFP in Nicotiana benthamiana and poplar reporter linesDepositorInsertCiU6.1 promoter
UseCRISPRExpressionPlantPromoterCiU6.1 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-14
Plasmid#246297PurposeEvaluation of CiU6.6c16 promoter (Pol III promoter) sequence variation for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertCiU6.6c16 promoter
UseCRISPRExpressionPlantMutationT-to-C (-2 from TSS)PromoterCiU6.6c16 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-11
Plasmid#246294PurposeEvaluation of CiU6.3c8 promoter (Pol III promoter) sequence variation for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertCiU6.3c8 promoter
UseCRISPRExpressionPlantMutationA-to-C (-23 from TSS)PromoterCiU6.3c8 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-24
Plasmid#246307PurposeEvaluation of a synthetic Pol III promoter based on the MtU6.6 promoter for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertMtU6.6m4 promoter
UseCRISPRExpressionPlantPromoterMtU6.6m4 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-25
Plasmid#246308PurposeEvaluation of a synthetic Pol III promoter based on the MtU6.6 promoter for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertMtU6.6m5 promoter
UseCRISPRExpressionPlantPromoterMtU6.6m5 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-27
Plasmid#246310PurposeEvaluation of PtU6.1 promoter (Pol III promoter) for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertPtU6.1 promoter
UseCRISPRExpressionPlantPromoterPtU6.1 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-1
Plasmid#246284PurposeEvaluation of AtU3b promoter (Pol III promoter) for CRISPR-Cas9 editing of mEGFP in Nicotiana benthamiana and poplar reporter linesDepositorInsertAtU3b promoter
UseCRISPRExpressionPlantPromoterAtU3b promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-32
Plasmid#246315PurposeEvaluation of VvU6.1 promoter (Pol III promoter) for CRISPR-Cas9 editing of mEGFP in Nicotiana benthamiana and poplar reporter linesDepositorInsertVvU6.1 promoter
UseCRISPRExpressionPlantPromoterVvU6.1 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-23
Plasmid#246306PurposeEvaluation of a synthetic Pol III promoter based on the MtU6.6 promoter for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertMtU6.6m1 promoter
UseCRISPRExpressionPlantPromoterMtU6.6m1 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-20
Plasmid#246303PurposeEvaluation of MtU6.6-189 promoter (Pol III promoter) deletion (189 bp) for CRISPR-Cas9 editing of mEGFP in Nicotiana benthamiana and poplar reporter linesDepositorInsertMtU6.6-189 promoter
UseCRISPRExpressionPlantPromoterMtU6.6-189 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-29
Plasmid#246312PurposeEvaluation of PtU6.2 promoter (Pol III promoter) for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertPtU6.2 promoter
UseCRISPRExpressionPlantPromoterPtU6.2 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-16
Plasmid#246299PurposeEvaluation of HbU6.2m1 promoter (Pol III promoter) sequence variation for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertHbU6.2m1 promoter
UseCRISPRExpressionPlantMutationA-to-G (-56 from TSS), C-to-T (-29), G-to-A (-24)PromoterHbU6.2m1 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-DEST47-SIRT2
Plasmid#242132PurposeExpression in mammalian cellsDepositorAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-miRFP703-eDHFR(69K6)-mSOS1-linkercat
Plasmid#214827PurposeEncoding mSOS1-linkercat fused to miRFP703DepositorInsertmiRFP703-eDHFR(69K6)-mSos1-linkercat
TagsmiRFP703ExpressionMammalianPromoterCAG promoterAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCSIIbleo-H2B-iRFP
Plasmid#214830PurposeEncoding nuclear-targeted iRFP713.DepositorInsertiRFP with nucleus-targeting sequence
UseLentiviralTagsH2B (human histone 2B)ExpressionMammalianPromoterEF-1αAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-PHOSPHO2-TEV-Twin-Strep
Plasmid#222016PurposeExpress human PHOSPHO2 protein (C-terminal Tobacco Etch Virus (TEV) protease cleavable Twin-Strep-fusion protein (ENLYFQGS-WSHPQFEK-(GGGS)2-GGSA-WSHPQFEK)) in mammalian cellDepositorInsertPHOSPHO2 (PHOSPHO2 Human)
TagsTEV cleavable site and Twin-Strep-tagExpressionMammalianMutationdeleted stop codon (TAA)Promoterchicken β-actin promoterAvailable SinceJan. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDSK519-cspB
Plasmid#207162PurposeExpresses codon-optimized cspB from Clavibacter michiganensis in a broad host range vectorDepositorInsertcspB
TagsHAExpressionBacterialPromoternptIIAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY380
Plasmid#182962PurposeAmp-resistant, low copy (p15A ori), E. coli 5'ptsI transcriptionally fused with GFP.DepositorInsertptsI
UseSynthetic BiologyTagsGFPAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY390
Plasmid#182963PurposeAmp-resistant, low copy (p15A ori), E. coli ptsI transcriptionally fused with GFP.DepositorInsertptsI
UseSynthetic BiologyTagsGFPAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only