We narrowed to 27,636 results for: GFP
-
Plasmid#183854PurposesfGFP reporter under the control of Mutant E. coli thiB TPP Riboswitch under the control of a Constitutive promoterDepositorInsertE. coli thiB TPP Riboswitch Randomized A nt90-94 regulated sfGFP
ExpressionBacterialPromoterJ23119 - Anderson PromoterAvailable SinceAug. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP C1-Eps8 ∆cap
Plasmid#74786Purposemammalian expression of the capping activity mutant Eps8 fused to GFPDepositorAvailable SinceMay 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pIHEU_miniSOG2 T2A H3.3A-EGFP
Plasmid#87411PurposeUAS vector to express Histone 3.3A GFP fusion and miniSOG2 in DrosophilaDepositorInsertmini singlet oxygen generator 2
ExpressionInsectAvailable SinceMarch 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
attB-GFP-Tet1-Poly(A)
Plasmid#65559PurposePlasmid for Bxb1-mediated recombination of the GFP-Tet1 cDNA into a MIN-tagged locusDepositorAvailable SinceAug. 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
attB-GFP-Dnmt3b1-Poly(A)
Plasmid#65531PurposePlasmid for Bxb1-mediated recombination of the GFP-Dnmt3b1 cDNA into a MIN-tagged locusDepositorInsertDnmt3b (Dnmt3b Mouse)
UseMouse Targeting; Bxb1TagsGFPExpressionMammalianMutationisoform 1Available SinceAug. 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-hsRPA14 (MSW#503)
Plasmid#208069PurposeExpression of GFP-tagged hsRPA3 in human cellsDepositorAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRRL-GFPGO-PGK-Neo
Plasmid#136890PurposeLentivirus for base editing activatable GFP expression in mammalian cellsDepositorInsertGFPGO
UseLentiviralMutationATG>ACGPromoterSFFVAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-p19Ink4d-IRES-GFP
Plasmid#52221Purposeretroviral bicistronic expression of p19Ink4d and GFPDepositorAvailable SinceApril 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSEM396 - mosTI unc-119 - NNN - operon - gfp - tbb-2
Plasmid#182353PurposeGFP co-expression cloning vector for mosTI(unc-119). Transgene inserted upstream of gpd-2 operon::gfp::tbb-2 3'UTR. MCS or Golden Gate (BsaI: tgcc - MCS - tgag)DepositorTypeEmpty backboneExpressionWormAvailable SinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i3-msfGFP
Plasmid#180322Purposemammalian expression of human SEPT9_i3 fused to monomeric superfolder GFPDepositorAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRS405 VAC8-GFP
Plasmid#166836PurposeExpresses Vac8-GFP in yeasts.DepositorAvailable SinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
His-GFP-Rim2
Plasmid#170869PurposeMammalian expression of His-GFP-Rim2.DepositorInsertRegulating synaptic membrane exocytosis protein 2 (Rim 2) (Rims2 Rat)
Tags(His)6 and EGFPExpressionMammalianPromoterCMVAvailable SinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
YIplac211-sGFP-Vrg4
Plasmid#160904PurposeExpresses GFP-Vrg4 in yeast cellsDepositorInsertVRG4
TagsGFPExpressionYeastAvailable SinceNov. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAc-GFP-dSUMO
Plasmid#85696Purposeexpression of GFP-SUMO1 in Drosophila cellsDepositorAvailable SinceMarch 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-Xl-VSP1-GFP
Plasmid#51883Purposeexpression of Xl-VSP1 -GFP fusion in Xenopus oocytes or mammalian cellsDepositorAvailable SinceMarch 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
PHR-GFP-p65
Plasmid#183929PurposeOptogenetic PHR domain coupled to GFP and p65 activation domain; binds to CIBN upon blue light exposureDepositorAvailable SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-FLAG-GFP-Ubl4A
Plasmid#86921PurposeTo express Ubl4A tagged with FLAG-EGFP at N- terminus.DepositorAvailable SinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTFCP2-donor
Plasmid#112308PurposeCRISPR donor plasmid to tag human transcription factor TFCP2 with GFPDepositorInsertTFCP2 homology arms flanking EGFP-IRES-Neo cassette (TFCP2 Human)
UseCRISPRAvailable SinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZBTB12-donor
Plasmid#113802PurposeCRISPR donor plasmid to tag human transcription factor ZBTB12 with GFPDepositorInsertZBTB12 homology arms flanking EGFP-IRES-Neo cassette (ZBTB12 Human)
UseCRISPRMutationrs9267664, rs9267663Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only