We narrowed to 17,253 results for: REV

#72125

Expresses the extracellular region of the PlexinA4 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

March 2, 2016

Academic Institutions and Nonprofits only

#61407

Expresses human OTUD1 (OTU domain) in E. coli.

David Komander

Mevissen et al Cell. 2013 Jul 3;154(1):169-84. doi: 10.

March 12, 2015

Academic Institutions and Nonprofits only

#8724

Kurt Thorn

Sheff et al Yeast 2004 Jun;21(8):661-70.

Feb. 15, 2007

Academic Institutions and Nonprofits only

#87394

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87399

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#73285

EasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XI-1

Irina Borodina

Jessop-Fabre et al Biotechnol J. 2016 Aug;11(8):1110-7. doi

Nov. 23, 2016

Academic Institutions and Nonprofits only

#50644

Wei-Lih Lee

Markus et al Traffic. 2015 Jul;16(7):773-86. doi: 10.

Jan. 22, 2014

Academic Institutions and Nonprofits only

#50652

Wei-Lih Lee

Markus et al Traffic. 2015 Jul;16(7):773-86. doi: 10.

Jan. 15, 2014

Academic Institutions and Nonprofits only

#50647

Wei-Lih Lee

Markus et al Traffic. 2015 Jul;16(7):773-86. doi: 10.

Jan. 15, 2014

Academic Institutions and Nonprofits only