We narrowed to 10,125 results for: Uty
-
Plasmid#158260PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsFLAG.VSVg.CMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
PB-iRFP-STOP-ReNL
Plasmid#113965PurposePiggybac transposon plasmid CRISPR gene deletion activatable fluorescence. Constitutive iRFP670 under EF1A promoter, CMV promoter with two SV40 polyA followed by red-enhanced nanolantern (ReNL)DepositorInsertsiRFP670
ReNL
UsePiggybac transposonExpressionMammalianPromoterCMV - SV40-PolyA - SV40-PolyA and EF1AAvailable SinceDec. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKK-RNAi-nucCHERRYmiR-TEV-EGFP
Plasmid#105814PurposeFunctional studies using RNAi; rescue experiments; substituting protein for its different form. miRNA cassette with nuclear mCherry expression marker; your protein of interest with C-terminal EGFP.DepositorTypeEmpty backboneUseRNAi; Flp-in competentTagsTEV-EGFPExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
L4315 IL-10Ra CTEVp chain in PolyTX-mTagBFP2
Plasmid#244171PurposeConstitutive expression of a MESA CTEVp chain encoding (N to C): IL10RaSS-3xFLAG-IL10RaECD-IL10RaTMD-CTEVp(190K)-PRS(M)-VP64-ZF6aDepositorInsertMESA CTEVp chain with human IL-10Ra SS, ECD and TMD, CTEVp (190K), TEVp PRS (M in P1'), and synTF (VP64-ZF6) (IL10RA Human, Synthetic)
UseSynthetic BiologyTagsIL10Ra signal peptide - 3xFLAGExpressionMammalianMutationCTEVp_190KPromoterhEF1aAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4804 VEGFR1 CTEVp chain in PolyTX-mTagBFP2
Plasmid#244174PurposeConstitutive expression of a MESA CTEVp chain encoding (N to C): VEGFR1SS-3xFLAG-VEGFR1ECD-VEGFR1TMD-CTEVp(190K)-PRS(M)-VP64-ZF6DepositorInsertMESA CTEVp chain with human VEGFR1 SS, ECD and TMD, CTEVp (190K), TEVp PRS (M in P1'), and synTF (VP64-ZF6) (FLT1 Human, Synthetic)
UseSynthetic BiologyTagsVEGFR1 signal peptide - 3xFLAGExpressionMammalianMutationCTEVp_190KPromoterhEF1aAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4308 IL-10Rb NTEVp chain (human IgG VH SS) in PolyTX-mNeonGreen
Plasmid#244169PurposeConstitutive expression of a MESA NTEVp chain encoding (N to C): hIgGVHSS-3xFLAG-IL10RbECD-IL10RbTMD-NTEVp(75S)DepositorInsertMESA NTEVp chain with human IgG-VH SS, human IL-10Rb ECD and TMD, and NTEVp 75S mutant (IL10RB Human, Synthetic)
UseSynthetic BiologyTagshuman IgG VH signal peptide - 3xFLAGExpressionMammalianMutationNTEVp_75SPromoterhEF1aAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4312 IL-10Rb NTEVp chain (human CD8a SS) in PolyTX-mNeonGreen
Plasmid#244170PurposeConstitutive expression of a MESA NTEVp chain encoding (N to C): hCD8aSS-3xFLAG-IL10RbECD-IL10RbTMD-NTEVp(75S)DepositorInsertMESA NTEVp chain with human CD8a SS, human IL-10Rb ECD and TMD, and NTEVp (75S) (IL10RB Human, Synthetic)
UseSynthetic BiologyTagshuman CD8a signal peptide 3xFLAGExpressionMammalianMutationNTEVp_75SPromoterhEF1aAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4791 VEGFR2 NTEVp chain (75S NTEVp mutant) in PolyTX-mNeonGreen
Plasmid#244172PurposeConstitutive expression of a MESA NTEVp chain encoding (N to C): VEGFR2SS-3xFLAG-VEGFR2ECD-VEGFR2TMD-NTEVp(75S)DepositorInsertMESA NTEVp chain with human VEGFR2 SS, ECD and TMD, and NTEVp (75S) (KDR Human, Synthetic)
UseSynthetic BiologyTagsVEGFR2 signal peptide - 3xFLAGExpressionMammalianMutationNTEVp_75SPromoterhEF1aAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-FXN-P2A-mRuby2(miRE.FF4)-TS.FF6x1-bGH
Plasmid#235301PurposeComMAND open-loop circuit regulating FXN-P2A-mRuby2 (therapeutically relevant gene)DepositorInsertFXN-P2A-mRuby2 (FXN Human)
UseSynthetic BiologyExpressionMammalianPromoterEF1a (human EF1a)Available SinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-FXN-P2A-mRuby2-bGH
Plasmid#235300PurposeComMAND base gene regulating FXN-P2A-mRuby2 (therapeutically relevant gene)DepositorInsertFXN-P2A-mRuby2 (FXN Human)
UseSynthetic BiologyExpressionMammalianPromoterEF1a (human EF1a)Available SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-FXN-P2A-mRuby2(miRE.FF4)-TS.FF4x1-bGH
Plasmid#235302PurposeComMAND closed-loop circuit regulating FXN-P2A-mRuby2 (therapeutically relevant gene)DepositorInsertFXN-P2A-mRuby2 (FXN Human)
UseSynthetic BiologyExpressionMammalianPromoterEF1a (human EF1a)Available SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-PDGFRA-V561D-V5/HIS
Plasmid#234762PurposeExpression of the V561D mutant variant of human PDGFRA, which is associated with Gastrointestinal Stromal Tumor and GIST-Plus Syndrome, , constantly activatedDepositorInsertPDGFRA-V561D receptor tyrosine kinase, full length (PDGFRA Human)
TagsV5/HisExpressionMammalianMutationV561D substitutionPromoterCMVAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-PDGFRA-P577S-V5/HIS
Plasmid#234760PurposeExpression of the P577S mutant variant of human PDGFRA, which might be associated with MelanomaDepositorInsertPDGFRA-P577S receptor tyrosine kinase, full length (PDGFRA Human)
TagsV5/HisExpressionMammalianMutationP577S substitutionPromoterCMVAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-PDGFRA-R487L-V5/HIS
Plasmid#234761PurposeExpression of the R487L mutant variant of human PDGFRA, which might be associated with Gastrointestinal Stromal TumorDepositorInsertPDGFRA-R487L receptor tyrosine kinase, full length (PDGFRA Human)
TagsV5/HisExpressionMammalianMutationR487L substitutionPromoterCMVAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-PDGFRA-D842V-V5/HIS
Plasmid#234763PurposeExpression of the D842V mutant variant of human PDGFRA, which is associated with Gastrointestinal Stromal Tumor, constantly activatedDepositorInsertPDGFRA-D842V receptor tyrosine kinase, full length (PDGFRA Human)
TagsV5/HisExpressionMammalianMutationD842V substitutionPromoterCMVAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-PDGFRA-G853D-V5/HIS
Plasmid#234757PurposeExpression of the G853D mutant variant of human PDGFRA, which might be associated with MelanomaDepositorInsertPDGFRA-G853D receptor tyrosine kinase, full length (PDGFRA Human)
TagsV5/HisExpressionMammalianMutationG853D substitutionPromoterCMVAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-PDGFRA-T674I-V5/HIS
Plasmid#234756PurposeExpression of the T674I mutant variant of human PDGFRA, which is associated with Idiopathic Hypereosinophilic Syndrome, resistant to imatinibDepositorInsertPDGFRA-T674I receptor tyrosine kinase, full length (PDGFRA Human)
TagsV5/HisExpressionMammalianMutationT674I substitutionPromoterCMVAvailable SinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLX313_PELO_WT
Plasmid#228938PurposeConstitutive expression of wild-type human PELODepositorAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-PDGFRA-K627M-V5/HIS
Plasmid#234755PurposeExpression of the K627M kinase defective mutant variant of human PDGFRADepositorInsertPDGFRA-K627M receptor tyrosine kinase, full length (PDGFRA Human)
TagsV5/HisExpressionMammalianMutationK627M substitutionPromoterCMVAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only