We narrowed to 3,540 results for: cgas
-
Plasmid#229449Purposeknockout of WWTR1 (TAZ)DepositorAvailable SinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only
-
sgTAZ-R-1
Plasmid#229448Purposeknockout of WWTR1 (TAZ)DepositorAvailable SinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgMARK3-R-3
Plasmid#229439Purposeknockout of MARK3DepositorInsertsgMARK3-R-3 (MARK3 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterhU6;bU6;EFSAvailable SinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-intergenic-As
Plasmid#209026PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-intergenic-Lb
Plasmid#209030PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFlare9A-Clip2E9 Mutant
Plasmid#209575Purposeminigene construct for Clip2 E9 alternative splicing, potential PTBP2 binding sites are deletedDepositorInsertClip2 (Clip2 Mouse)
ExpressionMammalianMutationACGCGTTTCTGAATTCTTCTAACTGCCCTCAAATGCACGGTGGCATGTG…PromoterCMVAvailable SinceMarch 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQCXIH FRB Ubiqutin-BFP
Plasmid#202426PurposeTagBFP FKBP-rapamycin binding (FRB) dimerization domain fused to ubiquitinDepositorInsertFKBP-rapamycin binding (FRB) dimerization domain
UseLentiviralTagsUbiquitin, TagBFPAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shCALM2-1
Plasmid#193699PurposeConstitutive lentiviral expression of CALM2 shRNADepositorInsertCALM2 (CALM2 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-RBMS3
Plasmid#185557PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting RBMS3DepositorInsertRBMS3 gRNAs
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-HHIP
Plasmid#185551PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting HHIPDepositorInsertHHIP gRNAs
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX304-ARF5-T161A-mNeonGreen
Plasmid#162026PurposeFast cycling ARF mutantDepositorAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
Empty Bridge Control Zfp462-Klf4SE
Plasmid#127666PurposeEncodes for 4 gRNAs expressed from their individual hU6 promoters. Two gRNAs target the Zfp462 promoter while the other two target the Klf4 stretch enhancer.DepositorInsertgRNAs 129, 135, 115, 117
UseCRISPRExpressionMammalianPromoterhU6Available SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
CLK3 gRNA (BRDN0001147044)
Plasmid#77284Purpose3rd generation lentiviral gRNA plasmid targeting human CLK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CHKB gRNA (BRDN0001148182)
Plasmid#76866Purpose3rd generation lentiviral gRNA plasmid targeting human CHKBDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ERBB4 gRNA (BRDN0001146197)
Plasmid#76197Purpose3rd generation lentiviral gRNA plasmid targeting human ERBB4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
EPHA10 gRNA (BRDN0001146992)
Plasmid#76096Purpose3rd generation lentiviral gRNA plasmid targeting human EPHA10DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
EPHA10 gRNA (BRDN0001146813)
Plasmid#76098Purpose3rd generation lentiviral gRNA plasmid targeting human EPHA10DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDKL4 gRNA (BRDN0001149006)
Plasmid#76107Purpose3rd generation lentiviral gRNA plasmid targeting human CDKL4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAP3K6 gRNA (BRDN0001162255)
Plasmid#76012Purpose3rd generation lentiviral gRNA plasmid targeting human MAP3K6DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only