We narrowed to 26,145 results for: Nov
-
Plasmid#124153PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pBABE (hygro) mEOS2 hYAP 1-1beta
Plasmid#124156PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 (-) hYAP 1-1beta
Plasmid#124140PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP324-pAAV-FullH1TO-SaCa9sgRNAi(emx1sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113701PurposeDox-inducible H1 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP322-pAAV-FullU6TO-SaCa9sgRNAi(emx1-sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113699PurposeDox-inducible U6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONOR-PARK6e5-I368N
Plasmid#86154PurposeDonor plasmid for PARK6 exon5 I368N sequence. Also contains TagBFP and dTomatoDepositorInsertPINK1 exon 5 homology arms (PINK1 Human)
ExpressionBacterial and MammalianAvailable SinceJune 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAP1893-1
Plasmid#105248Purposehuman GFP11 with tagRFP 33bp downstream in Lamin A/C (recoded)DepositorInsertInsertion of GFP11 at cut tagRFP 33bp downstream (recoded *) in Lamin A/C (LMNA Human)
ExpressionBacterialAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV2_hSyn_Aurora_CA_Citrine
Plasmid#98219PurposeSlow cycling (open for minutes) step-function artificial anion conducting channelrhodopsin (aACR). High light sensitivity. Activation with green light, inactivation max with 625 nm (accelarates closure to ms). Not recommended for in vivo use. Codon optimized for mammalian expression.DepositorInsertSynthetic construct Aurora_C128A gene
UseAAVTagsCitrineExpressionMammalianMutationV59S, E83N, E90Q, E101S, V117R, E123S, C128A, P24…Promoterhuman synapsinAvailable SinceAug. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 E2F1 Flag(Δ193-359) (HindIII- BamHI- EcoRI)
Plasmid#70667PurposeHuman mutant of E2F1 lacking amino acids 193-359DepositorInsertE2F1 lacking residues 193 to 359 (E2F1 Human)
TagsFLAGExpressionMammalianMutationlacks amino acids 193-359PromotercmvAvailable SinceMay 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCOG40-HRS (257-276) Hs
Plasmid#83236PurposepGST-HRS (257-276) Hs, Expresses the GST-HRS in E.coliDepositorAvailable SinceNov. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFOSGE_COF4D03
Plasmid#70969PurposeGateway entry cloneDepositorInsertTaf12 (Taf12 Fly)
UseGateway entry vectorAvailable SinceDec. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFOSGE_CUS1F03
Plasmid#71071PurposeGateway entry cloneDepositorInsertSu(var)205 (Su(var)205 Fly)
UseGateway entry vectorAvailable SinceNov. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 E2F1 Flag(Δ 284−359)(HindIII- BamHI- EcoRI)
Plasmid#70669PurposeHuman mutant of E2F1 lacking amino acids 284 to 359DepositorInsertE2F1 lacking residues 284 to 359 (E2F1 Human)
TagsFlagExpressionMammalianMutationlacks amin acids 284 to 359PromotercmvAvailable SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-SPRED1-3'UTR (mut - miR-21 site1)
Plasmid#62580PurposeTranslational Luciferase Reporter encoding a mutated fragment of the SPRED1 3'UTR. The upstream miR-21 (site 1) binding site was mutated.DepositorInsertSPRED1 (SPRED1 Human)
UseLuciferaseMutationmiR-21 binding site 1 mutant (TAAGCTA --> TAGA…Available SinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-SPRED1-3'UTR (containing miR-21 sites)
Plasmid#62579PurposeTranslational Luciferase Reporter encoding a fragment of the 3'UTR of SPRED1 containing two miR-21 binding sites (sites 1 and 2)DepositorInsertSPRED1 (SPRED1 Human)
UseLuciferaseAvailable SinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-SPRED1-3'UTR (mut - miR-21 site 2)
Plasmid#62581PurposeTranslational Luciferase Reporter encoding a mutated fragment of the SPRED1 3'UTR. The downstream miR-21 binding site (site 2) was mutated.DepositorInsertSPRED1 (SPRED1 Human)
UseLuciferaseMutationmiR-21 binding site 2 mutant (TAAGCTA --> TAGA…Available SinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Flag-YAP-H122Y
Plasmid#33085DepositorAvailable SinceFeb. 10, 2012AvailabilityAcademic Institutions and Nonprofits only