We narrowed to 10,128 results for: Met
-
Plasmid#31748DepositorInsertKhc73 (Khc-73 Fly)
TagsGFPExpressionMammalianMutationContains only aa 1-432PromoterMetallothioneinAvailable sinceNov. 8, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Hygro dn-cHSF1
Plasmid#134732PurposeLentiviral expression vector for constitutively active dominant-negative HSF1DepositorInsertdn-cHSF1 (HSF1 Human)
UseLentiviralExpressionMammalianMutationDeletion of amino acids 186-202, 379−529PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV/TO Zeo dn-cHSF1
Plasmid#134734PurposeLentiviral expression vector for inducible expression of a constitutively active dominant-negative HSF1DepositorInsertdn-cHSF1 (HSF1 Human)
UseLentiviralExpressionMammalianMutationDeletion of amino acids 186-201, 380−529PromoterCMV/TOAvailabilityAcademic Institutions and Nonprofits only -
pLV-puro-NUDT5_70-74-RTLHY-AAAAA-3xFLAG
Plasmid#258078PurposeOverexpressionDepositorInsertNUDT5 (NUDT5 Human)
UseLentiviralTags3xFLAGMutation70-74 RTLHY to AAAAA, limits interaction with PPATAvailable sinceJuly 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pc5139-pEGFP-H3.1-K36M
Plasmid#241430PurposeExpresses human Histone H3.1 as fusion to GFP with lysine to methionine point mutation of K36 from plasmid H3.1 using primers: forward: ACCGGTGGCGTGATGAAACCTCATCGC & reverse: GCGATGAGGTTTCATCDepositorInserthuman Histone H3.1 (H3C1 Human)
TagsEGFPExpressionMammalianMutationlysine at position 36 to methionine (K36M)PromoterCMVAvailable sinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pNos-myrGFP
Plasmid#253595PurposeExpress myrGFP under Drosophila nanos promoterDepositorInsertmyrGFP
Tagsmyristoylation signalExpressionInsectPromoterNanos promoterAvailable sinceMay 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1alpha-FLAG-HA-CAD_S1900A-HA-IRES-Neo
Plasmid#253789PurposepLV lentiviral expression vector encoding FLAG- and HA-tagged human CAD bearing S1900A mutation linked to neomycin selection by an IRES under a human EF1alpha promoter.DepositorInsertCAD (CAD Human)
UseLentiviralTagsFLAG-HA and HAExpressionMammalianMutationS1900APromoterEF1alphaAvailable sinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1alpha-FLAG-HA-CAD_WT-HA-IRES-Neo
Plasmid#253784PurposepLenti lentiviral expression vector encoding FLAG- and HA-tagged human wild-type CAD linked to neomycin selection by an IRES under a human EF1alpha promoter.DepositorAvailable sinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1alpha-FLAG-HA-CAD_S1900A-HA-IRES-Neo
Plasmid#253785PurposepLenti lentiviral expression vector encoding FLAG- and HA-tagged human CAD bearing S1900A mutation linked to neomycin selection by an IRES under a human EF1alpha promoter.DepositorInsertCAD (CAD Human)
UseLentiviralTagsFLAG-HA and HAExpressionMammalianMutationS1900APromoterEF1alphaAvailable sinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1alpha-FLAG-HA-CAD_S1900D-HA-IRES-Neo
Plasmid#253786PurposepLenti lentiviral expression vector encoding FLAG- and HA-tagged human CAD bearing S1900D mutation linked to neomycin selection by an IRES under a human EF1alpha promoter.DepositorInsertCAD (CAD Human)
UseLentiviralTagsFLAG-HA and HAExpressionMammalianMutationS1900DPromoterEF1alphaAvailable sinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1alpha-FLAG-HA-CAD_S1900D-HA-IRES-Neo
Plasmid#253790PurposepLV lentiviral expression vector encoding FLAG- and HA-tagged human CAD bearing S1900D mutation linked to neomycin selection by an IRES under a human EF1alpha promoter.DepositorInsertCAD (CAD Human)
UseLentiviralTagsFLAG-HA and HAExpressionMammalianMutationS1900DPromoterEF1alphaAvailable sinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1alpha-FLAG-HA-CAD_WT-HA-IRES-Neo
Plasmid#253788PurposepLV lentiviral expression vector encoding FLAG- and HA-tagged human wild-type CAD linked to neomycin selection by an IRES under a human EF1alpha promoter.DepositorAvailable sinceMarch 31, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lyn-FRB_star-P2A-mVenus-FKBP-5ptase(D343A)
Plasmid#241306PurposeMammalian expression of Lyn-FRB_star and mVenus-FKBP-5ptase(phosphatase-dead mutant) of INPP5EDepositorInsertINPP5E (INPP5E Human)
TagsmVenus, FKBPExpressionMammalianMutation214-644 aa, D343APromoterCMVAvailable sinceDec. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
p3382_KanR_7p
Plasmid#247308PurposeProduction of Pinocembrin in Escherichia coli, cloned by BASIC assembly, based on 3382 in Carbonell et al. 2018DepositorInsertsAtCHI
Sc4CL
AtCHS
AtPAL
ExpressionBacterialPromoterPLacUV5 with lac operator and Ptrc with lac opera…Available sinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAVLINKv1-pCALM1-Cre-3'-CUX1-FLAG
Plasmid#244325Purpose3' AAVLINK plasmid for CUX1 expressionDepositorAvailable sinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGFP-mTet1-Cys pc2332
Plasmid#201696PurposeExpresses of GFP-tagged mTet1-Cys in mammalian cellsDepositorInsertTet1 Cys (Tet1 Mouse)
TagsGFPExpressionMammalianMutationOnly GFP-tagged Cysteine Rich Domain (CRD) of Tet1PromoterCAGAvailable sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF.DEST51-PTPN11(D425A,C459S)-Clover
Plasmid#215526PurposeExpression vector with a clover-tagged phosphatase-inactive Shp2 mutant (D425A,C459S)DepositorInsertPTPN11 (PTPN11 Human)
TagsCloverExpressionMammalianMutationD425A, C459S (Phosphatase inactive)PromoterEF1aAvailable sinceSept. 3, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pENTR2b-PTPN11(D425A,C459S)-Clover
Plasmid#215520PurposeGateway entry vector with a clover-tagged phosphatase-inactive Shp2 mutant (D425A,C459S)DepositorInsertPTPN11 (PTPN11 Human)
UseGateway CloningTagsCloverMutationD425A, C459S (Phosphatase inactive)PromoternoneAvailable sinceSept. 3, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLenti-K36M TAIL[1-44]-3AID-HA-2A-mCherryBSD
Plasmid#225872PurposeLentiviral expression of AID degron tagged H3.3(K36M) histone tail corresponding to amino acids 1-44 and mCherry fused BlasticidinRDepositorUseLentiviral and Synthetic BiologyTags3xAID HA and T2A-mCherryExpressionMammalianMutationamino acids 1-44 from H3.3 K36MAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKC50
Plasmid#226778PurposeExpresses Drosophila UNC-104(V6M) in insect cellsDepositorInsertDrosophila unc-104 (V6M) (unc-104 Fly)
TagssfGFP and 2xStrepIIExpressionInsectMutationchanged Valine 6 to MethionineAvailable sinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only