We narrowed to 27,842 results for: gfp
-
Plasmid#220591PurposeRetroviral mammalian expression vector with GFP for overexpression of mouse PHGDHDepositorInsertMs PHGDH (Phgdh Mouse)
UseRetroviralAvailable sinceFeb. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-RNF110
Plasmid#126547PurposeExpresses GFP-tagged RNF110 in mammalian cellsDepositorAvailable sinceJuly 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
cmamxA1-GFP
Plasmid#107195PurposeExpresses porcine annexin A1-GFP fusion protein for live cell imaging, all type II Ca2+ binding sites deletedDepositorInsertcmannexin A1
TagsGreen Fluorescent ProteinExpressionMammalianMutationexchanges Asp170Ala, Glu255Ala, Glu330Ala, all ty…PromoterCMVAvailable sinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
Mouse 3' Ubf AID GFP PuroR
Plasmid#127901PurposeHDR (donor) Plasmid for Inserting AID-GFP-2A-Puro into the 3' end of the Mouse Ubf GeneDepositorInsertUbf (Ubtf Mouse, Mustard Weed)
UseDonor plasmidTagsGFP, AID, PuroRMutationInserting GFP AID 2A Puro into mouse 3' UbfAvailable sinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
Mouse 5' Srcap AID GFP Puro
Plasmid#127903PurposeHDR (donor) Plasmid for Inserting PuroR-2A-GFP-AID into the 5' end of the Mouse Srcap GeneDepositorAvailable sinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRN3P-NLS-EGFP-deadBtgh-3NLS
Plasmid#194470PurposeEncodes for catalytically inactive bacterial O-GlcNAcase BtGH84 fused to enhanced GFP and NLSs for effective nuclear localization, in backbone for T3 In Vitro Transcription.DepositorPublicationInsertBtGH84
UseFor in vitro transcription from t3 promoter after…TagsSV40 Nuclear Localization Signal, SV40 Nuclear Lo…MutationAspartic Acid 242 (in Dennis et al.) changed to A…Available sinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAC150-RFP-EGFP-LGALS3 R186S
Plasmid#175779PurposePiggyBac Vector expressing GFP-RFP-LGALS3 R186SDepositorAvailable sinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBiex PKC - Peptide 8 GFP RFP
Plasmid#83564PurposeExpresses a GFP-RFP FRET sensor containing the catalytic domain of PKCalpha and a short peptide substrate derived from the EGF receptor.DepositorInsertPKC alpha (PRKCA Human)
Tags10 nm ER/K Helix, FLAG purification tag, TEV Prot…ExpressionBacterial and InsectMutationOnly catalytic domain of PKC (aa 335-672)PromoterT7 PromoterAvailable sinceNov. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
Unc104_K560GFP
Plasmid#129773PurposeExpresses worm Kinesin-3 Unc104 head and neck linker, dimerized through kinesin-1 neck-coil and coil-1 to 560 and GFP taggedDepositorInsertUnc104 (unc-104 Nematode)
TagsGFP and His6ExpressionBacterialMutationTruncation at 361, fused to kinesin-1 starting Al…Available sinceNov. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
CAG-loxP-3xpA-H2BsfGFP-tdTomato - T2A APGST -XE
Plasmid#113839PurposeHistone H2B-superfolder GFP and tdTomato linked by T2A (APGST linker -XE)DepositorInsertH2B-sfGFP-T2A-tdTomato
ExpressionMammalianAvailable sinceSept. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-anti-GFP(LaG17) PAGER(TF)
Plasmid#229997PurposeExpresses anti-GFP PAGER(TF) (high reversibility) in mammalian cells; used with NanoLuc-Arrestin-TEVp (Addgene #125228) and UAS-Firefly Luciferase reporter (Addgene #104840)DepositorInsertIL2SP-Aro6-LaG17-TEVcs-ALFA-KORD(RAA)-LOV-TEVcs-Gal4
UseAAVExpressionMammalianMutationV360A/R361A on KORDPromoterCMVAvailable sinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
Antibody#192039-rAbPurposeAnti-Ankyrin-G (Human) recombinant mouse monoclonal antibodyDepositorRecommended applicationsImmunocytochemistry and ImmunohistochemistryReactivityHuman, Mouse, and RatSource speciesMouseIsotypeIgG2aTrial sizeAvailable to purchaseAvailable sinceFeb. 24, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits
-
rAAV-CAG::FLEX-rev:: hM4D-2a-GFP (AAV1)
Viral prep#52536-AAV1PurposeReady-to-use AAV1 particles produced from rAAV-CAG::FLEX-rev:: hM4D-2a-GFP (#52536). In addition to the viral particles, you will also receive purified rAAV-CAG::FLEX-rev:: hM4D-2a-GFP plasmid DNA. CAG driven, Cre-dependent expression of hM4D and GFP. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsGFPAvailable sinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT TO GFP hBub1 K821R
Plasmid#59813PurposeAllows the integration of GFP hBub1 K821R in the genome and Tet-inducible expression.DepositorInsertBub1 (BUB1 Human)
TagsEmGFPExpressionMammalianMutationK821RPromoterhybrid human cytomegalovirus (CMV)/TetO2 promoterAvailable sinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn_ChroME2f_GCaMP8m_ST_P2A-NLS-PA-GFP
Plasmid#258857PurposeAAV expression of soma-targeted ChroME2f fused to GCaMP8m-P2A-photoactivable GFPDepositorInsertChroME2f
UseAAVTagsGCaMP8m-ST-P2A-NLS-PA-GFPExpressionMammalianPromoterhSynAvailable sinceSept. 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
cTRE-GFP-miR30_shRen
Plasmid#135666PurposeIntroduce Dox-inducible (TRE promoter) GFP cDNA plus miR30-embedded shRenilla into (ES) cells by recombination-mediated cassette exchangeDepositorInsertshRenilla
UseMouse TargetingAvailable sinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available sinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFastBac_HT_B_6xHis-TEV-GFP-NBR1
Plasmid#190928PurposePlasmid for the expression and purification of GFP labelled NBR1. Internal reference: SMC 914DepositorAvailable sinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-GFP-LC3-mRuby3
Plasmid#184898PurposeStable expression of GFP-LC3-mRuby3 in mammalian cells to measure autophagic fluxDepositorInsertLC3B
TagsEGFP and mRuby3ExpressionMammalianAvailable sinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-Tollip M240A,F241A
Plasmid#178051PurposeGFP fused to human Tollip cDNA carrying mutations in the CUE domain. Localisation and expression in mammalian cells.DepositorInsertToll-Interacting Protein (TOLLIP Human)
TagsGFPExpressionMammalianMutationChanged Methionine 240 to Alanine and changed Phe…PromoterCMVAvailable sinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by