We narrowed to 16,166 results for: grna
-
Plasmid#80188Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available sinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001162248)
Plasmid#80189Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available sinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001149361)
Plasmid#80190Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available sinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001148852)
Plasmid#80175Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available sinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001147812)
Plasmid#80176Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available sinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorPublicationInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available sinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTUU
Plasmid#159749PurposeUbiquitin promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by mTomato fluoresce.DepositorPublicationInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable sinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCUU
Plasmid#159747PurposeUbiquitin promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by CFP fluoresce.DepositorPublicationInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable sinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEE
Plasmid#159746PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by CFP fluoresce.DepositorPublicationInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable sinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_G3BP2_G1
Plasmid#127112DepositorInsertgRNA G3BP2 (G3BP2 Human)
UseCRISPRAvailable sinceAug. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-pgaC
Plasmid#154919PurposeaTc inducible gRNA targeting pgaC along with arabinose-inducible lambda red enzymesDepositorInsertgRNA targeting pgaC
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterpTetAvailable sinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
hsLEMD2-pX330
Plasmid#179511PurposeEncodes gRNA for human LEMD2DepositorInsertgRNA for LEMD2
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJA14
Plasmid#59929PurposegRNA for cleavage at rde-1(H974) locus in C elegansDepositorInsertrde-1(H974) gRNA
UseCRISPRPromoterU6Available sinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9_sgAAVS1
Plasmid#199213PurposeAll-in-one plasmid encoding eSpCas9 and sgRNA targeting the AAVS1 site in human cells.DepositorInsertAAVS1-gRNA
UseCRISPRPromoterhuman U6Available sinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMEL15
Plasmid#107921Purposenat based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable sinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
B2M Bulldozer (gRNA crB2M_13)
Plasmid#84381PurposeThis plasmid expresses a gRNA targeting the first exon of human B2M. Most efficient gRNA targeting B2M, leading to ablation of B2M and MHC class I surface expression in 50% of transfected cellsDepositorInsertB2M Bulldozer crB2M_13 gRNA
ExpressionMammalianPromoterhU6 promoterAvailable sinceJuly 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
1518_pAAV-U6-SA-eGFP-gRNA-HLP-SACas9-HA-OLLAS-spA
Plasmid#109316PurposePlasmid for liver-specific expression of AAV SaCas9 with a gRNA against eGFPDepositorInserteGFP gRNA
UseAAV and CRISPRExpressionMammalianAvailable sinceJan. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
gRNA NIA TLS1
Plasmid#196980PurposeExpresses two gRNAs targeting Arabidopsis NIA1 gene for knockout. Each gRNA is fused to TLS1 mobility signal that confers graft mobility.DepositorInsertAtNIA1 gRNAs fused to TLS1 tags
ExpressionPlantPromoterpU6-26, pU6-29Available sinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX552 EF1a DIO Chronos GFP_Vgat gRNA
Plasmid#215277PurposeExpresses Vgat gRNA in a Cre dependent Chronos GFP vectorDepositorInsertVgat gRNA
UseAAVExpressionMammalianPromoterU6Available sinceJuly 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX552-hSyn-DIO-GCaMP8f_Grin1 gRNA
Plasmid#215281PurposeExpresses Grin 1 gRNA in a Cre dependent GCaMP8f vectorDepositorInsertGrin1 gRNA
UseAAVExpressionMammalianMutationSee Depositor Comments BelowPromoterU6Available sinceJuly 8, 2024AvailabilityAcademic Institutions and Nonprofits only