We narrowed to 10,373 results for: epo
-
Plasmid#48354PurposeContributes an IRES-ECFP cassette as the 3’-module during MultiSite Gateway cloning of a bi-cistronic mRNA shared with a two-part fusion protein encoded by the 5′- and middle modules.DepositorInsertIRES_ECFP
UseGateway entry vectorMutationECFP translation is mediated by an IRES. Contains…PromoternoneAvailable SinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMiR-CIP2A-miR-375-mutA-E
Plasmid#53754PurposeLuciferase reporter assay for CIP2A with point mutation on miR-375 binding sitesDepositorInsertCIP2A (CIP2A Human)
UseLuciferaseMutationMutation on miR-375 binding site A-E (refer to ci…Available SinceJuly 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL3E-hGPR56 e1m promoter perisylvian polymicrogyria
Plasmid#52299PurposeReporter for mutated human GPR56 exon 1m promoter activity. It contains a 15-bp deletion in a conserved noncoding element. The mutated human GPR56 e1m promoter was inserted into pGL3E.DepositorInsertADGRG1 adhesion G protein-coupled receptor G1 (ADGRG1 Human)
UseLuciferaseMutation15-bp deletion in the promoterPromoterHuman GPR56 e1m promoterAvailable SinceApril 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1-nAChr-beta3-CFP
Plasmid#50485Purposethis report is the first to directly measure nAChr subunit stoichiometry using FRET and plasma membrane localization of Alpha6 and Beta3 containing receptors using TIRFDepositorInsertnAChRBeta3 subunit, isoform 1 (Chrnb3 Mouse)
TagsCFPExpressionMammalianMutationCFP fusion in M3-M4 loop (after residue P379). O…PromoterCMVAvailable SinceJan. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEMS1538
Plasmid#29261PurposeHigh copy homologous recombination plasmid for gene targeting at the mouse Hprt locus containing Ple67 (FEV MiniPromoter) driving a lacZ reporterDepositorInsertPle67 (FEV Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceOct. 28, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
LentiX-(loxPcon-TET-DIAL-YB-TATA)-mCherry-HRasG12V-bGH-EFS-rtTA-TagBFP-WPRE
Plasmid#246367PurposeloxPcon TET-DIAL Reporter Lentivirus with YB_TATA expressing mCherry-HRasG12V in the presence of DOX and rtTA and editable by Cre recombinase. Contains rtTA-TagBFP expressed divergenty.DepositorAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror GFP[ENE(C8351G)-mascRNA(mut 8356-8370)](pAVA3871)
Plasmid#239352PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of MALAT1 ENE(C8351G)-mascRNA(mut 8356-8370) reporter.DepositorInsertMALAT1 ENE(C8351G)-mascRNA(mut 8356-8370)
ExpressionMammalianMutationMALAT1 ENE(C8351G)-mascRNA(mut 8356-8370: ctacgac…Available SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-KRAS-G12R-IRES-mCherry
Plasmid#221023PurposeFluorescent reporter for expressing the KRAS G12R mutant CDSDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-KRAS-G12S-IRES-mCherry
Plasmid#221024PurposeFluorescent reporter for expressing the KRAS G12S mutant CDSDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-KRAS-G12A-IRES-mCherry
Plasmid#221020PurposeFluorescent reporter for expressing the KRAS G12A mutant CDSDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-KRAS-G12C-IRES-mCherry
Plasmid#221021PurposeFluorescent reporter for expressing the KRAS G12C mutant CDSDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-KRAS-G12D-IRES-mCherry
Plasmid#221022PurposeFluorescent reporter for expressing the KRAS G12D mutant CDSDepositorAvailable SinceAug. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-Ubi-lsl-EGFP-nls-mCherry:fli1aep-CreI-zf1-BFP (JDW 1236)
Plasmid#229816PurposeA Tol2 based expression vector containing an Ubi driven loxP flanked GFP followed by an nls-mCherry reporter with fli1-TagBFP-zCre in the opposite direction.DepositorInsertloxp-EGFP-stop-lox
UseTol2 based expression vectorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-Hsp70-H2B-mCerulean-lsl-mScarlet-fli1-zCre-I-BFP (JDW 1233)
Plasmid#229841PurposeA Tol2 based expression vector with the Hsp70 promoter driving a cre dependent switch reporter. Contains an endothelial driven creDepositorInsertloxp-H2B-mCerulean-2xStop-loxP
UseCre/Lox; Tol2 based expression vectorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn T21R(I18R+M72E)-F8.2(S54L+T127A)-T2A-mCherry
Plasmid#225591PurposeAAV transgene plasmid with hSyn promoter for expression of catalytically dead TRIM21 RING(I18R+M72E)-F8.2(S54L+T127A) anti-tau degrader with a self-cleaving T2A-mCherry fluorescent expression reporterDepositorInsertT21R(I18R+M72E)-F8.2(S54L+T127A)-T2A-mCherry
UseAAVTagsmCherryExpressionMammalianPromoterhSynAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2-MYC(Δ1-143)-GFP-IRES-mCherry (ΔTAD)
Plasmid#231233PurposeMYC stability reporter construct with deletion of the N-terminal region (residues 1-143) for transient expression in mammalian cellsDepositorInsertMYC (MYC Human)
ExpressionMammalianMutationTAD deleted (delta1-143); numbering based on sequ…Available SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist-SARS-CoV-2 Spike-deltaC18 XBB.1.16 F456L
Plasmid#212455PurposeEncodes SARS-CoV-2 variant XBB.1.16 Spike F456L for pseudovirus productionDepositorInsertSARS-CoV-2 Spike XBB.1.16 F456L (S Severe acute respiratory syndrome coronavirus 2)
ExpressionMammalianMutationSee Depositor Comments.PromoterCAGAvailable SinceSept. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-miRFP680-NES-p2A-ezrin-T567A-mRuby3-IRES-Neo
Plasmid#222637PurposeEzrin activation reporter, T567 phosphorylation deficientDepositorInsertmiRFP680-NES-p2A-ezrin-T567A-mRuby3 (EZR Human)
UseLentiviralTagsmRuby3MutationT567APromoterEF1aAvailable SinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD R2187A
Plasmid#169827PurposeExpresses C-terminal flag-tagged CAD with mutation at reported trimerization interface of the ATCase domain of CADDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationR2187A, T456A S1406A S1859A; TCCC -> AGTC sile…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only