We narrowed to 16,111 results for: grna
-
Pooled library#1000000127PurposeCRISPR gRNA mouse knockout pooled library - Unassigned1DepositorAvailable sinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pJMP1183
Plasmid#119254Purposerfp "test" strainDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialMutationD10A and H840AAvailable sinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pUC CBA-SpCas9D10Anickase.EF1a-BFP.sgLMNApair4
Plasmid#98975PurposeCas9 Homologous Recombination Reporter. SpCas9D10A nickase and a pair of sgRNAs targeting hLMNA. Generates breaks with 94bp 3' overhangs. TagBFP.DepositorInsertLMNA sgRNAs pair 4 and Cas9(D10A)
ExpressionMammalianAvailable sinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBFC0619
Plasmid#186690PurposeVcDART under control of Lac promoter, Vc_2xBsaI_NT gRNA, GmR+sfGFP cargoDepositorInsertstnsA
tnsB
tnsC
tnsD
tniQ
cas8-cas5 fusion
cas7
cas6
Vc_2xBsaI_NT (Guide Stuffer) crRNA
Tn7 transposon
GmR+sfGFP VcDART Cargo
ExpressionBacterialPromoterPLacAvailable sinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pgRGFP
Plasmid#82695PurposeExpresses gRNA of interest under U6 promoter (cloning by BpiI) and GFP under PGK promoter.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterPGK, U6Available sinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSECRETS-A
Plasmid#196986PurposeFor SECRETS protocol to screen for gRNA activity and specificity: bacterial expression Cas9 in the presence of anhydrotetracycline (aTc).DepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterpltetO1Available sinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pxpr_050-wt-ltr
Plasmid#182646Purposelentiviral expression of gRNA scaffold, contains intact LTRDepositorInsertNone
UseLentiviralExpressionMammalianAvailable sinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTK473
Plasmid#114715PurposesgRNA for LGN's N-terminal locusDepositorInsertLGN sgRNA
Available sinceOct. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL2-1
Plasmid#109008PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable sinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL3-2
Plasmid#109010PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable sinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgULK1-1
Plasmid#109004PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable sinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMZ381
Plasmid#59899PurposeCombination adh1:cas9/rrk1:sgRNA for CRISPR genome editing in fission yeast: sgRNA targeted against ade6-L469DepositorInsertsCas9
rrk1:sgRNA
UseCRISPRExpressionYeastMutationSilent muation of the CspCI siteAvailable sinceOct. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
PM-TD!TA
Plasmid#48655PurposeBacterial TD crRNA expression: targets TD to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial TD crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable sinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TA
Plasmid#48649PurposeBacterial SP crRNA expression: targets SP to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable sinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
Bassik lab Mouse CRISPR-Cas9 Deletion Library - Unassigned2
Pooled library#1000000128PurposeCRISPR gRNA mouse knockout pooled library - Unassigned2DepositorAvailable sinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJZC41
Plasmid#62332PurposesgRNA (no RNA aptamer addition) with PCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
PCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSAG1::CAS9-U6::sg290860-6
Plasmid#59855PurposeEncodes CAS9 nuclease (GFP fusion) under control of the Toxoplasma gondii SAG1 promotor. Vector also provides U6 controlled expression of a single guide RNA for CRISPR disruption of TGME49_290860.DepositorInsertCRISPR sg290860-6
UseCRISPR; ; toxoplasma gondiiAvailable sinceOct. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPbU6_hdhfr/yfcu_Cas9
Plasmid#216423PurposeEmpty backbone to express gene specific gRNA from the Plasmodium berghei U6 promoter and the Cas9 nuclease for traditional CRISPR editing.DepositorPublicationTypeEmpty backboneUseCRISPR; Expression in plasmodium bergheiExpressionBacterialAvailable sinceApril 28, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
px330-GAPDH
Plasmid#136940PurposeNHEJ assay. sgRNA/Cas9 plasmid. Target DSB at human GAPDH; induce CD4+ deletion rearrangement by pairing w/ px330-CD4DepositorAvailable sinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only