We narrowed to 9,807 results for: CAG
-
Plasmid#48673PurposeMammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with N. meningitidis Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
PB CAG-F-bpA-F-L-td-sfGFP
Plasmid#133580PurposeCAG tdGFP FLP/FRT reporter piggyBac transposon (bpA stop)DepositorInsertTandem dimer superfolder GFP
UseFlp/frtExpressionMammalianAvailable SinceMarch 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmyc-GFP-TNRC6A
Plasmid#41999DepositorAvailable SinceMarch 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
M-ST1-sgRNA
Plasmid#48672PurposeMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
UseCRISPRPromoterhUAvailable SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
Cas9 MDC123
Plasmid#59184Purpose2x35S promoting Glycing Max codon optimized Cas9 with bar plant selectionDepositorInsertGlycine Max codon optimized Cas9
UseCRISPRExpressionPlantPromoter2X35SAvailable SinceNov. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.Flex.Twitch2B.WPRE.SV40
Plasmid#100039PurposeAAV expression of FLEXed Twitch2B driven by CAG promoter. Twitch 2B is a fluorescent reporter for calcium signalingDepositorInsertTwitch2B
UseAAVExpressionMammalianPromoterCAGAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-tdTHC
Plasmid#112621Purposeexpression plasmid with CAG promoter driving multicistronic cassette H2BtdTomato_p2A_HygroR_p2A_CreERt2DepositorInsertsUseCre/LoxTagstdTomatoExpressionMammalianPromoterCAGAvailable SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCXN2-BCL6 (CXN-BCL6)
Plasmid#40346DepositorAvailable SinceOct. 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-4031NES
Plasmid#105241PurposeA Förster resonance energy transfer (FRET) biosensor for AMPK activity with cyan and yellow fluorescent protein.DepositorInsertAMPK-EV
ExpressionMammalianPromoterCAGGSAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-sCAG-eGFP-ACAP1
Plasmid#203800PurposeAAV vector plasmid expressing human ACAP1 fused to eGFP under a short variant of the CAG (sCAG) promoterDepositorAvailable SinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRho-DsRed
Plasmid#11156DepositorAvailable SinceMay 25, 2006AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-jGCaMP8s-WPRE (AAV9)
Viral Prep#179256-AAV9PurposeReady-to-use AAV9 particles produced from AAV-CAG-jGCaMP8s-WPRE (#179256). In addition to the viral particles, you will also receive purified AAV-CAG-jGCaMP8s-WPRE plasmid DNA. CAG-driven expression of calcium sensor GCaMP8s. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hPPP3CA-FLAG
Plasmid#179134PurposeExpression vector of human protein phosphatase 3, catalytic subunit, alpha isoform (PPP3CA) tagged with FLAG at C-terminus, CAG promoter, rabbit globin poly(A) signal.DepositorInsertprotein phosphatase 3, catalytic subunit, alpha isoform (PPP3CA Human)
TagsFLAGExpressionMammalianAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
SS9_RNA
Plasmid#71656PurposeSS9-targeting gRNA for co-transformation with pSS9DepositorInsertSS9 gRNA
UseCRISPRExpressionBacterialPromoterJ23119Available SinceJan. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Dlg4-GFP KI
Plasmid#131477PurposeEndogenous tagging of PSD95: C-terminal (amino acid position: R721)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
TDP43 NOTAG1
Plasmid#28206DepositorAvailable SinceJuly 1, 2011AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsTNRC6A
Plasmid#25035DepositorAvailable SinceJune 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_hSt1Cas9_LMD9
Plasmid#110626PurposeA single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD-9) and its U6-driven sgRNA.DepositorInsertsSt1Cas9 LMD-9
sgRNA for St1Cas9
UseCRISPR and Synthetic BiologyTagsSV40 NLSExpressionMammalianPromoterCAG and hU6Available SinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-RB1
Plasmid#87836PurposeLentiCRISPR v2 was modified into an all-in-one dox inducible system. The addition of doxycycline induces Cas9-2A-eGFP. The U6 promoter drives constitutive expression of an sgRNA targeting human RB1.DepositorInsertsgRB1 (RB1 Human)
UseCRISPR and Lentiviral; Doxycycline inducible; egf…ExpressionMammalianPromoterTight TRE promoter and U6Available SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMGS7 (AAVS1sgRNA)
Plasmid#126582PurposeA CRISPR/Cas9 construct to target the AAVS1 locus in humansDepositorInsertAAVS1 sgRNA
ExpressionMammalianAvailable SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only