We narrowed to 13,842 results for: CAR
-
Plasmid#122103PurposeAAV-mediated expression of Chronos-tdTomato under the EF1α1.1 promoter in frt/reversed (Flp-dependent) manner. tdTomato has codons varied to reduce recombination.DepositorInsertChronos-tdTomato
UseAAVTagstdTomatoExpressionMammalianPromoterEF1a(1.1kb short version)Available SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hAsCas12a-RVR(S542R/K548V/N552R)-NLS(nucleoplasmin)-3xHA (AAS1065)
Plasmid#114092PurposeCAG promoter expression plasmid for human codon optimized AsCas12a-RVR(S542R/K548V/N552R) nuclease with C-terminal NLS and HA tagDepositorInserthuman codon optimized AsCas12a (S542R/K548V/N552R)
TagsNLS(nucleoplasmin) and 3xHAExpressionMammalianMutationS542R, K548V and N552RAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pInducer20_SLC38A2_wt
Plasmid#156182PurposeDox-inducible expression of sgRNA-resistant SLC38A2 wild-type cDNA.DepositorInsertSLC38A2 (SLC38A2 Human)
ExpressionMammalianMutationSilent mutations to prevent targeting by sgRNA: T…PromoterTREAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-NLS(SV40)x2-rAPOBEC1-gs-XTEN-gs-hdAsCas12a(D908A)-gs-UGI-NLS(SV40)(AsBE1.4) (RTW1008)
Plasmid#114080PurposeCAG promoter expression plasmid for human codon optimized AsBE1.4DepositorInserthuman codon optimized DNase-inactive (D908A) enAsCas12a fused to N-terminal rAPOBEC1 and C-terminal UGI (AsBE1.4)
Tags2x SV40 NLS and SV40 NLSExpressionMammalianAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR D-TOPO-C3_9
Plasmid#60258PurposeThis plasmid contains a human pancreatic islet active enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.DepositorInsertNKX6-1 enhancer (NKX6-1 Human)
UseEntry vectorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.AU1.VSVg_NGFR
Plasmid#158232PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.AU1.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO-PHB-4
Plasmid#122231PurposeExpresses shRNA targeting the 3' UTR of human PHBDepositorAvailable SinceAug. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 C3_25
Plasmid#60305PurposeThis plasmid contains a human pancreatic islet active enhancer, a minimal promoter and a luc2 gene.DepositorAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
Venus1-DeltaCT-STAT3
Plasmid#123178PurposeExpresses a STAT3 deletion mutant (without the C-terminus from SH2 domain) fused to the 1-157 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus1 (aa 1-157) (STAT3 Human)
TagsVenus1 (aa 1-158) for bimolecular fluorescence co…ExpressionMammalianMutationDeletion of the SH2 and TAD domains (C-terminus, …Available SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.AU1.VSVg_NGFR
Plasmid#158239PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsNWS.AU1.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hYAP1-Y2B)-PGKpuro2ABFP-W
Plasmid#163178PurposeLentiviral gRNA plasmid targeting human YAP1 gene, co-expression of BFP tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pICE-EGFP-FLAG-TK1
Plasmid#161919PurposeExpresses human TK1 with a N-terminal GFP-FLAG tag. Confers Puromycin resistance. Inducible in T-REx cells.DepositorAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-FLPX-rc [ChrimsonR-GFP]
Plasmid#118295PurposeAAV-mediated expression of ChrimsonR-GFP under the CAG promoter in frt/reversed (Flp-dependent) manner.DepositorInsertChrimsonR-GFP
UseAAVTagsGFPExpressionMammalianMutationChrimson K176R mutantPromoterCAGAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hAsCas12a(E174R/S542R)-NLS(nucleoplasmin)-3xHA (AAS826)
Plasmid#114091PurposeCAG promoter expression plasmid for human codon optimized AsCas12a(E174R/S542R) nuclease with C-terminal NLS and HA tagDepositorInserthuman codon optimized AsCas12a (E174R/S542R)
TagsNLS(nucleoplasmin) and 3xHAExpressionMammalianMutationE174R and S542RAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEXSISERS_FLuc_loxP-PuroR
Plasmid#177866PurposeCloning Backbone for Firefly-luciferase-based EXSISERS containing loxP-sites flanked PuroR cassetteDepositorInsertFLuc-based EXSISERS
UseCRISPR, Cre/Lox, Luciferase, Synthetic Biology, a…TagsFLAGExpressionMammalianAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 ATP5O(5’UTR)-SL-FF
Plasmid#85491PurposeFirefly luciferase under the control of ATP5O 5'UTR followed by a stem-loopDepositorInsert5'UTR of ATP5O followed by stem loop (ATP5PO Human)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianAvailable SinceJan. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 ATP5O(TISU)-FF
Plasmid#85489PurposeFirefly luciferase under the control of ATP5O TISUDepositorInsertFull TISU element of ATP5O (ATP5PO Human)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianMutation2nd and 3rd codon of luciferase were modified fro…Available SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
CRY2low-tdTomato-Raf1
Plasmid#104176PurposeExpresses fusion of CRY2low mutant (CRY2 aa1-491 R489E A491D) with tdTomato and Raf1DepositorExpressionMammalianMutationCRY2 aa 1-491 truncation, R489E A491DPromoterCMVAvailable SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only