We narrowed to 19,702 results for: CAL
-
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CAG_Kinprola_PKA-mEGFP-NLS3__WPRE-SV40
Plasmid#233365PurposeCAG driven expression of the PKA activity recorder Kinprola_PKA fused to mEGFP for mammalian cell expression through AAV transductionDepositorInsertKinprola_PKA-mEGFP-NLS3X
UseAAVTagsmEGFP-NLS3XPromoterCAGAvailable SinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT61
Plasmid#223433PurposeT-DNA vector for dSpCas9 mediated gene activation for monocot plants; NGG PAM; dSpCas9-Act3.0 was driven by ZmUbi1 and the sgRNA was driven by ZmUbi1 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-dSpCas9-Act3.0-ZmUbi-gRNA scaffold 2.0-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CAG_NES-Kinprola_PKA-mTagBFP2_WPRE-SV40
Plasmid#233364PurposeCAG driven expression of the PKA activity recorder Kinprola_PKA fused to mTagBFP2 for mammalian cell expression through AAV transductionDepositorInsertNES-Kinprola_PKA-mTagBFP2
UseAAVTagsNES and mTagBFP2PromoterCAGAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEND-303_Cacnes_tetR
Plasmid#225618PurposeC. acnes with tetR-based inducible expression of mCherry. pBRESP36A with P(PPA_RS09745)+RBS_2+TetR // P(BBa_23119-TetO2)+RBS_1+mCherryDepositorInsertTetR
UseSynthetic BiologyTags6xHisExpressionBacterialMutationCodon optimized for Cutibacterium acnesAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pLV-H1-shSRGAP2B/C#1-hsynapsin-EGFP
Plasmid#220796PurposeshRNA plasmid against human SRGAP2B/C genes (#1) with EGFP expression in neuronsDepositorInsertEGFP
Available SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBAD02_CBASS_Escherichia_coli_703128
Plasmid#224394PurposeFor expression of the type I CBASS system encoded by Escherichia coli 703128DepositorInsertEcCdnD_4TM
ExpressionBacterialAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBAD02_CBASS_Escherichia_coli_BWH59
Plasmid#224393PurposeFor expression of the type I CBASS system encoded by Escherichia coli BWH59DepositorInsert2TM_EcCdnD
ExpressionBacterialAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1-OST4-mCherry (EcoRV) (XH26)
Plasmid#206475PurposeExpression in Schneider cells for imagingDepositorTypeEmpty backboneExpressionInsectAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-TASL(FL)
Plasmid#221263PurposeExpression of TASL in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
actb2-SecAnxaV-mKate2-acry-EGFP
Plasmid#123628PurposeUbiquitous zebrafish expression vector containing secreted human AnnexinV tagged to mKate2. Parton lab clone BDN.DepositorInsertAnnexinA5
TagsmKate2Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMx/ATP11C-HA
Plasmid#209237PurposeMammalian expression of ATP11CDepositorAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG/ATP8B3-HA
Plasmid#209211PurposeMammalian expression of ATP8B3DepositorAvailable SinceOct. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET22b 6His SpyCatcher-GRFT
Plasmid#204502PurposeBacterial expression of GRFT with N-terminal SpyCatcher fusion and GS linkerDepositorInsertGRFT
UseSynthetic BiologyTags6xHis and SpyCatcherExpressionBacterialPromoterT7Available SinceSept. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF3405
Plasmid#144881PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL0_24 [pBBR1-UP ORI]
Plasmid#198937PurposeLevel 0 partDepositorInsertpBBR1-UP ORI
UseSynthetic BiologyMutationS100L (C299T)Available SinceJuly 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPKm-112
Plasmid#90494PurposepcDNA3 - pCMV - MTAD - PIF3, expresses Phytochrome interacting factor 3 (PIF3) and minimal transactivation domain (MTAD), under CMV promoterDepositorInsertMTAD-PIF3
ExpressionMammalianAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
HT116_pAAV_hSyn-DiO-SomQuasAr6b_EGFP
Plasmid#190879PurposeCre-on expression of soma-targeted QuasAr6b under an neuronal promoterDepositorInsertsoma-targeted QuasAr6b
UseAAVTagsEGFPPromoterhSynAvailable SinceNov. 17, 2022AvailabilityAcademic Institutions and Nonprofits only