We narrowed to 5,947 results for: aaas
-
Plasmid#228351PurposeConstitutive ALX-0081 expressionDepositorInsertMFalpha(2xAdv)-LE-ALX-0081-3A-FLAG-His
UseAffinity Reagent/ AntibodyTagsAAA linker followed by FLAG-His6 and MF_ secretio…ExpressionYeastPromoterKpGAPDH promoterAvailable SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT1461
Plasmid#228319PurposeDoxycycline-regulatable ALX-0081 expressionDepositorInsertMFalpha(2xAdv)-ALX-0081-3A-FLAG-His
UseAffinity Reagent/ AntibodyTagsAAA linker followed by FLAG-His6 and MF_ secretio…ExpressionYeastPromoterDoxycycline-regulatable synthetic promoter (KpTc7…Available SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLAS2w.Phyg-CHST8 (3A)
Plasmid#232651Purposeexpresses CHST8 REP-to-AAA mutant in mammalian cellsDepositorInsertCHST8 (3A) (CHST8 Human)
UseLentiviralTagsFlagExpressionMammalianMutationR258A, E259A, P260APromoterCMVAvailable SinceMarch 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLYS6-METTL17-LYRMut-FLAG
Plasmid#220877PurposeExpressing METTL17-LYRMut-FLAGDepositorInsertMETTL17 (METTL17 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationChanged the LYP domain to AAAAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
psicheck2-MAIP1mut
Plasmid#203604PurposeReporter plasmid carrying MAIP1 3'UTR with mutated miR27b target sequencesDepositorInsertmatrix AAA peptidase interacting protein 1 (MAIP1 Human)
UseLuciferaseExpressionMammalianMutationmiR-27b target sequences in the 3'UTR was mu…PromoterSV40Available SinceOct. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-dCas9
Plasmid#125687PurposeGene knockdown for actinomycetesDepositorInsertstreptomyces codon optimized spdCas9, sgRNA casette
UseCRISPR and Synthetic BiologyPromoterermE*/tipAAvailable SinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSWAP_Entry_T2
Plasmid#184864PurposepSwap plasmid part containing the T2 sgRNA module for the Swap and Drop recombination system.DepositorInsertlacZalpha,ccdB
ExpressionBacterialAvailable SinceJan. 3, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSWAP_Entry_T1
Plasmid#184863PurposepSwap plasmid part containing the T1 sgRNA module for the Swap and Drop recombination system.DepositorInsertlacZalpha,ccdB
ExpressionBacterialAvailable SinceJan. 3, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDropVn
Plasmid#184873PurposeChromosomal transfer helper plasmid with sgRNAs (one fixed, one flexible) for Vibrio natriegens genome editing protocol.DepositorInsertlacZalpha,ccdB
ExpressionBacterialAvailable SinceJan. 3, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
MK1283
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCBC-DT1T2.2
Plasmid#134752PurposePCR template for sgRNA cloningDepositorInsertsgRNA-AtU6_29p
UseCRISPRAvailable SinceDec. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCBC-MT1T2.2
Plasmid#134751PurposePCR template for sgRNA cloningDepositorInsertsgRNA-TaU3p
UseCRISPRAvailable SinceDec. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-AagRNA
Plasmid#121953PurposeMammalian expression, Genome editing, gRNA scaffoldDepositorInsertAaCas12b tracrRNA/crRNA duplex
ExpressionMammalianAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pG3GB411
Plasmid#134748PurposepGreen3 CRISPR/Cas9DepositorInsertCRISPR/Cas9
UseCRISPRPromotergRNA- OsU3, zCas9-Ubi1Available SinceDec. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-tetR
Plasmid#238043PurposeModified ADEPT-pCas9 with sfGFP under TtrB promoter for tetrathionate (TTR) sensing.DepositorInsertsfGFP
UseSynthetic BiologyPromoterttrBAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3A-CDS
Plasmid#136043PurposeUPF3A shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GCAGAAACCATTCTAAAGAAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-VR
Plasmid#62286Purposeexpression of VR sgRNA from the arabinose-inducible promoterDepositorInsertVR sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_2_Lb
Plasmid#155054PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only