We narrowed to 14,266 results for: cas9
-
Plasmid#227006PurposeMammalian expression of Nuclease active S. iniae Cas9DepositorInsertCas9
UseCRISPRTags3xFLAG, SV40 NLSExpressionMammalianPromoterCMVAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Spa-Cas9
Plasmid#227007PurposeMammalian expression of Nuclease active S. parasanguinis Cas9DepositorInsertCas9
UseCRISPRTags3xFLAG, SV40 NLSExpressionMammalianPromoterCMVAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Sub-Cas9
Plasmid#227008PurposeMammalian expression of Nuclease active S. uberis Cas9DepositorInsertCas9
UseCRISPRTags3xFLAG, SV40 NLSExpressionMammalianPromoterCMVAvailable SinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
M-SP-sgRNA
Plasmid#48671PurposeMammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
7xNLS-pMJ915v2-sfGFP
Plasmid#88922PurposeFor expression of modified SpyCas9 in e.coli.DepositorInsertsCas9
T7
UseCRISPRExpressionBacterialAvailable SinceMay 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pG3H-PE3max-attR1R2
Plasmid#213049PurposeDestination vector Expressing nCas9 and RT fusion protein and carrying Gateway recombination sitesDepositorInsertsCas9 nickase
M-MLV Reverse Transcriptase
UseNote: this plasmid needs helper pvs1-vir2 for rep…ExpressionPlantMutationH840A, R240K, N413K,Available SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRel-Hyg
Plasmid#227582PurposeRelease plasmid with Cas9 working cassette, hygromycin resistance, and pSG5 repliconDepositorInsertCas9
UseCRISPRAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJSC272 - Bacterial expression plasmid for SpCas9 Cluster 5 + Q926A variant
Plasmid#101236PurposeBacterial expression plasmid for SpCas9 Cluster 5 + Q926A variantDepositorInsertSpCas9 variant K918A/V922A/R925A/Q926A
Tags10x His, MBP, and TEV siteExpressionBacterialMutationK918A, V922A, R925A and Q926APromoterT7Available SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pORE303N
Plasmid#194438PurposeCRISPR, Cas9 driven by double 35S, nptII for plant selection, KpnI site for gRNA insertionDepositorInsertCas9
UseCRISPRExpressionPlantPromoter2x35SAvailable SinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCas9-J23109
Plasmid#113150PurposePlasmid constitutively expressing Cas9 proteinDepositorInsertCas9
ExpressionBacterialAvailable SinceDec. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
px459 VRER
Plasmid#101716PurposesgRNA/SpCas9 expression plasmid with Cas9 VRER mutations (NGCG PAM)DepositorInsertSpCas9 VRER
Tags3xFLAG-NLS and NLSExpressionMammalianMutationVRER (D1135V, G1218R, R1335E and T1337R)Available SinceOct. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRM055 His-TEV-Cas9 6xNLS 0C
Plasmid#196246PurposeExpression of NLS-rich Cas9 (0 Cys residues, mammalian codon optimized)DepositorInsertCas9
ExpressionBacterialPromoterT7Available SinceAug. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAS9-TPC
Plasmid#61478PurposeBinary expression vector with A.th. codon-optimized Cas9 for conventional cloningDepositorInsertCas9
UseCRISPRExpressionPlantPromoterPcUbi4-2Available SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBBK95 pCAS-Tyr-[gRNA: 2xBsaI+NotI cut sites] (HygR)
Plasmid#179079PurposeSp.Cas9 and gRNA yeast expression vector for HDR-based gRNA introduction. Selection = Hygromycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK94 pCAS-Tyr-[gRNA: 2xBsaI+NotI cut sites] (KanR)
Plasmid#179078PurposeSp.Cas9 and gRNA yeast expression vector for HDR-based gRNA introduction. Selection = Kanamycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK05 pCAS-Tyr-[gRNA: BsaI GFP dropout] (NatR,AmpR)
Plasmid#178989PurposeSp.Cas9 and gRNA yeast expression vector for HDR-based gRNA introduction. Selection = Nourseothricin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUb-Cas9-mCherry_cU6:6-sgRNA
Plasmid#190598PurposeThe plasmid encodes S. pyogenes Cas9 and mCherry separated by a T2A peptide under an Aedes aegypti polyubiquitin promoter. It also expresses a sgRNA scaffold under a Culex quinquefasciatus U6 promoterDepositorInsertsCas9
sgRNA
UseCRISPRTagsmCherry - separated by T2APromoterAedes aegypti polyubiquitin and Culex quinquefasc…Available SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-(-30)dGFP-9xGGS-Cath-NLS-Cas9-6xHis
Plasmid#62373PurposeExpression of (-30)dGFP-9xGGS-Cath-NLS-Cas9-6xHis in bacterial cellsDepositorInsert(-30)dGFP-9xGGS-Cath-NLS-Cas9-6xHis
Tags(-30)dGFP, 6xHis tag, Cathepsin cleavage site, an…ExpressionBacterialMutationY67S amino acid substitution in (-30)GFP renders …PromoterT7Available SinceJune 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
px330 EZH2 - pDY052
Plasmid#171107PurposeExpresses Cas9 and an sgRNA targeting EZH2DepositorInsertCas9
ExpressionMammalianAvailable SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAH237
Plasmid#121146PurposeExpression of both nmt41p-cas9 and rrk1p-gRNA (LEU2 marker) for CRISPR genome editing in fission yeastDepositorInsertsgRNA cassette
humanized Streptococcus pyogenes Cas9
UseCRISPRTagsFlagExpressionYeastPromoterS.pombe rrk1 and nmt41Available SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only