We narrowed to 1,988 results for: cas9 expression vector
-
Plasmid#85612PurposeMulti-gRNA delivery vector containing ugtP-gRNA.P395T for Bacillus subtilisDepositorInsertugtP-gRNA.P395T
ExpressionBacterialAvailable SinceJan. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAW019-2
Plasmid#85614PurposeInducible dCas9 integration vector for Bacillus subtilisDepositorInsertdcas9
ExpressionBacterialPromoterPxylA (B. megaterium)Available SinceJan. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWD509
Plasmid#73739PurposeGateway compatible [1-2] Entry Vector encoding 2xNLS-FLP-D5DepositorInsert2xNLS-FLP-D5
ExpressionWormMutationG5DAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Afp
Plasmid#99697PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Afp promoter, vector allows for activation of mouse Afp, can be packaged and delivered as AAVDepositorAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEF-ABEmax
Plasmid#164415PurposeEF1alpha promoter + ABEmax (derived from #112095). Mammalian cell adenosine base editor expression vector.DepositorInsertABEmax
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterEF1-alphaAvailable SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV CMV-driven AcrIIA4-scaffold (2xBsmBI sites)
Plasmid#120297PurposeAAV vector for expression of AcrIIA4 (no miR binding sites, control vector)DepositorInsertAcrIIA4
UseAAV and CRISPRTagsFLAGExpressionMammalianAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLSB-NAT
Plasmid#166698PurposeCombined sgRNA/Cas9 pLSB vector with natMX6 (cloNAT) marker. Golden Gate-ready for cloning custom sgRNA sequences.DepositorInsertstRNA promoter : sgRNA cassette
adh15 promoter : Cas9 codon-optimised for S. pombe
ExpressionYeastPromoteradh15 promoter and tRNA promoterAvailable SinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLSB-KAN
Plasmid#166700PurposeCombined sgRNA/Cas9 pLSB vector with kanMX6 (G418) marker. Golden Gate-ready for cloning custom sgRNA sequences.DepositorInsertstRNA promoter : sgRNA cassette
adh15 promoter : Cas9 codon-optimised for S. pombe
ExpressionYeastPromoteradh15 promoter and tRNA Ser promoterAvailable SinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLSB-HYG
Plasmid#166699PurposeCombined sgRNA/Cas9 pLSB vector with hphMX6 (hygromycin) marker. Golden Gate-ready for cloning custom sgRNA sequences.DepositorInsertstRNA promoter : sgRNA cassette
adh15 promoter : Cas9 codon-optimised for S. pombe
ExpressionYeastPromoteradh15 promoter and tRNA promoterAvailable SinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
Adeno EA
Plasmid#64071PurposeAdenovirus for the expression of gRNAs targeting intron 19 of murine Alk and intron 14 of Eml4DepositorInsertU6_sgRNA(Alk)_U6_sgRNA(Eml4)_CBh_FLAG-Cas9
UseAdenoviralTagsFLAG-Cas9PromoterU6 and CBhAvailable SinceJuly 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYTK-DN4
Plasmid#180285PurposeKanR multi-gene yeast expression vector (GFP-dropout)DepositorInsertConLS' - GFP - ConRE' - KanR - CEN6/ARS4
ExpressionBacterial and YeastAvailable SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYTK-DN6
Plasmid#180287PurposeHygR multi-gene yeast expression vector (GFP-dropout)DepositorInsertConLS' - GFP - ConRE' - HygR - CEN6/ARS4
ExpressionBacterial and YeastAvailable SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYTK-DN5
Plasmid#180286PurposeNatR multi-gene yeast expression vector (GFP-dropout)DepositorInsertConLS' - GFP - ConRE' - NatR - CEN6/ARS4
ExpressionBacterial and YeastAvailable SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDG462
Plasmid#100903PurposeSpCas9n (D10A Nickase mutant) with 2A-Puro and a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of DSBs with no off-target cuts.DepositorInsertshumanized CRISPR associated protein 9 Nickase
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTags3xFLAG and T2A-PuroRExpressionMammalianMutationD10A mutant converts to NickasePromoterCBh and U6Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDG461
Plasmid#100902PurposeSpCas9n (D10A Nickase mutant) with 2A-EGFP and a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of DSBs with no off-target cuts.DepositorInsertshumanized CRISPR associated protein 9 Nickase
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTags3xFLAG and T2A-EGFPExpressionMammalianMutationD10A mutant converts to NickasePromoterCBh and U6Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
PB-UniSAM
Plasmid#99866PurposeEncodes for Cas9-VP64, MS2-p65-HSF1, mCherry and for the gRNA 2.0DepositorInsertUniSAM-mCherry + U6-gRNA2.0
UseCRISPR and Synthetic Biology; Dcas9-sam activationExpressionMammalianMutationBbsI sites in CDS were ablated by consensus mutat…PromoterEF1aAvailable SinceAug. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGGDestTol2LC-5sgRNA
Plasmid#64243Purposedestination vector for five U6x:sgRNA cassettesDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGGDestTol2LC-4sgRNA
Plasmid#64242Purposedestination vector for four U6x:sgRNA cassettesDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 5, 2015AvailabilityAcademic Institutions and Nonprofits only