We narrowed to 9,951 results for: pcas
-
Plasmid#107727PurposeKnock out of EB1 in human cells by CRISPR/Cas9DepositorAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-roxSTOProx-LynEGFP
Plasmid#133923PurposeReporter expressing membrane targeted EGFP for visualization of neuronal morphology upon Dre-based recombinationDepositorInsertLynEGFP
ExpressionMammalianAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i1 sgRNA / hSpCas9
Plasmid#172825PurposeMammalian expression of a sgRNA targeting the intron 1 position 1 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-SP-CLSTN2-3xHAtag
Plasmid#191693PurposeFor expression coding sequencing of CLSTN2DepositorInsertsignal peptide, full length coding sequence of CLSTN2 and 3xHAtag
ExpressionMammalianMutationWTAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG Fzd7 GFP
Plasmid#66106Purposeexpression of chicken Fzd7 GFPDepositorAvailable SinceOct. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAG-MCS-DsRed
Plasmid#164091Purposeexpression of DsRed-tagged proteins under CAG promoterDepositorInsertDsRed
TagsDsRedExpressionMammalianPromoterCAGAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAFNF-PSDd1.2-GFP
Plasmid#125581PurposeFlp-dependent expression of PSD d1.2-GFP (a deletion mutant of PSD-95 fused to GFP) in mammalian cells.DepositorAvailable SinceJuly 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBT316_pattB-pCA-GFP-pA
Plasmid#52548Purposefor Phic31 integrase-mediated transgene integrationDepositorInsertsPhiC31o attB (full length)
GFP
ExpressionMammalianAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCAG-EGFP-Snapin
Plasmid#118743PurposeExpresses EGFP tagged SnapinDepositorAvailable SinceNov. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX458-3xHA-SpCas9
Plasmid#130968Purpose3xHA tagged Cas9 from S. pyogenes with T2A-EGFP and cloning backbone for sgRNADepositorInsert3xHA-NLS-SpCas9
UseCRISPRTags3x HA, EGFP, and NLSExpressionMammalianPromoterCbhAvailable SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCaSpeR-act5cB-QF#7m1
Plasmid#46126DepositorInsertQF#7m1
ExpressionInsectAvailable SinceAug. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCAG-LSS-mOrange
Plasmid#89688PurposepCAG promoter driving LSS-mOrangeDepositorInsertLSS-mOrange
UseSynthetic BiologyExpressionMammalianAvailable SinceApril 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAG-ArCas12a-2AeGFP
Plasmid#123632PurposeMammalian expression, Genome editingDepositorInsertArCas12a
Tags3xHA tagExpressionMammalianAvailable SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX459V2.0-SpCas9-HF4
Plasmid#108295PurposepX459 V2.0 (Plasmid #62988) with the Y450A, N497A, R661A, Q695A, and Q926A mutationsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1-G7
Plasmid#173203PurposeExpresses the ATP1A1 G7 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 intron 17. pX330-like plasmid.DepositorInsertATP1A1 G7 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCASP-SptP120-TD-HilA
Plasmid#153330PurposeTriggers secretion of SptP120 fused to the HA4-7c12 Tandem Monobody from Salmonella upon induction with arabinoseDepositorInsertSptP120-HA4-7c12 Tandem Monobody
UseSalmonella expressionAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-dHeFSpCas9
Plasmid#92116PurposeExpression plasmid for human codon-optimized dead/inactive increased fidelity HeFSpCas9 (without U6-sgRNA coding sequence)DepositorInsertdead/inactive HeFSpCas9 with FLAG tag
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationD10A, N497A, R661A, Q695A, H840A, K848A, Q926A, K…PromoterCbhAvailable SinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAG-AviMta3-3xFiBsd
Plasmid#140962Purposefull-length wt Avi-Mta3-3XFLAG-iBsd cDNA w/CAG promoter and Blasticidin resistance, cloned from mouse ES cellsDepositorInsertmetastasis associated 3 (Mta3 Mouse, Synthetic)
Tags3xFLAG, Avi, and TEVExpressionMammalianPromoterCAGAvailable SinceOct. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBW829_pCAG-pExpr-LUT
Plasmid#87554PurposeEncodes Boolean Look-up Table logic in response to Cre, Flp, PhiC31, Vika, B3, and Bxb1 recombinasesDepositorInsertEGFP
UseCre/Lox and Synthetic BiologyExpressionMammalianAvailable SinceAug. 7, 2017AvailabilityAcademic Institutions and Nonprofits only