We narrowed to 10,545 results for: Rras;
-
Plasmid#212990PurposeMammalian cell expression of SARS-CoV-2 Spike protein of OMICRON.EG5 variantDepositorInsertpαH-S-GSAS/EG.5 (S )
TagsHRV 3C cleavage site (before tags) C terminal on …ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterCMVAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
gCH130 (crCD55-4_crB2M-1_crKIT-2_crCD81-1)
Plasmid#217340PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertsUseCRISPR and LentiviralPromoterhU6Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-2P-OMICRON
Plasmid#180593PurposeMammalian cell expression of SARS-CoV-2 Spike protein variant OMICRON with furin side replaced by GSAS and with 2 Proline substitution at 986 and 987DepositorInsertSpike (S-GSAS-2P-OMICRON) (S Severe acute respiratory syndrome coronavirus 2)
TagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-OMICRON
Plasmid#180423PurposeMammalian cell expression of SARS-CoV-2 Spike protein variant OMICRON with furin side replaced by GSASDepositorInsertSpike (S-GSAS-OMICRON) (S Severe acute respiratory syndrome coronavirus 2)
TagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceFeb. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
gCH132 (crCD55-4_crB2M-1_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217341PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertsUseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
Musunuru-Cowan TALEN Kit
Plasmid Kit#1000000034PurposeThis collection allows the efficient assembly of TALEN constructs with custom repeat arrays, each containing 15 repeats for expression in mammalian cells.DepositorAvailable SinceJuly 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
Antibody#198594-rAbPurposeAnti-PSD-95 (Human) chimeric recombinant antibody. The hybridoma-derived heavy chain variable sequence and kappa light chain are fused to a chicken IgY Fc.DepositorRecommended ApplicationsWestern BlotReactivityHumanSource SpeciesChickenIsotypeIgYTrial SizeAvailable to purchaseAvailable SinceApril 3, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#193439-rAbPurposeAnti-NPY (Human) recombinant mouse monoclonal antibodyDepositorRecommended ApplicationsImmunocytochemistryReactivityHuman, Mouse, and RatSource SpeciesMouseIsotypeIgG2aTrial SizeNot available to purchaseAvailable SinceApril 11, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#196561-rAbPurposeAnti-PSD95 (Human) chimeric recombinant antibody. The hybridoma-derived heavy chain variable sequence and kappa light chain are fused to a rabbit IgG Fc.DepositorRecommended ApplicationsWestern BlotReactivityHumanSource SpeciesRabbitIsotypeIgGTrial SizeAvailable to purchaseAvailable SinceMarch 10, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#198267-rAbPurposeAnti-GFP chimeric recombinant antibody. The hybridoma-derived heavy chain variable sequence and kappa light chain are fused to a chicken IgY Fc.DepositorRecommended ApplicationsWestern BlotReactivitySyntheticSource SpeciesChickenIsotypeIgYTrial SizeNot available to purchaseAvailable SinceApril 3, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#196560-rAbPurposeAnti-GFP chimeric recombinant antibody. The hybridoma-derived heavy chain variable sequence and kappa light chain are fused to a rabbit IgG Fc.DepositorRecommended ApplicationsWestern BlotReactivitySyntheticSource SpeciesRabbitIsotypeIgGTrial SizeAvailable to purchaseAvailable SinceFeb. 24, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#209607-rAbPurposeAnti-Lhx6.1 (Mouse) recombinant mouse monoclonal antibodyDepositorRecommended ApplicationsImmunocytochemistryReactivityMouseSource SpeciesMouseIsotypeIgG2aTrial SizeAvailable to purchaseAvailable SinceAug. 2, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#201859-rAbPurposeAnti-VGlut1 (Rat) chimeric recombinant antibody. The hybridoma-derived heavy chain variable sequence and kappa light chain are fused to a rat IgG2a Fc.DepositorRecommended ApplicationsWestern BlotReactivityRatSource SpeciesRatIsotypeIgG2aTrial SizeAvailable to purchaseAvailable SinceJuly 17, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#201860-rAbPurposeAnti-Arl13b (Mouse) chimeric recombinant antibody. The hybridoma-derived heavy chain variable sequence and kappa light chain are fused to a rat IgG2a Fc.DepositorRecommended ApplicationsWestern BlotReactivityMouseSource SpeciesRatIsotypeIgG2aTrial SizeAvailable to purchaseAvailable SinceJuly 17, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#203877-rAbPurposeAnti-PSD-95 (Human) chimeric recombinant antibody. The hybridoma-derived heavy chain variable sequence and kappa light chain are fused to a rat IgG2a Fc.DepositorRecommended ApplicationsWestern BlotReactivityHumanSource SpeciesRatIsotypeIgG2aTrial SizeAvailable to purchaseAvailable SinceJuly 17, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#198001-rAbPurposeAnti-Arl13b (Mouse) chimeric recombinant antibody. The hybridoma-derived heavy chain variable sequence and kappa light chain are fused to a rabbit IgG Fc.DepositorRecommended ApplicationsWestern BlotReactivityMouseSource SpeciesRabbitIsotypeIgGTrial SizeAvailable to purchaseAvailable SinceApril 3, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#198263-rAbPurposeAnti-GFP chimeric recombinant antibody. The hybridoma-derived heavy chain variable sequence and kappa light chain are fused to a rabbit IgG Fc.DepositorRecommended ApplicationsWestern BlotReactivitySyntheticSource SpeciesRabbitIsotypeIgGTrial SizeAvailable to purchaseAvailable SinceApril 3, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#198265-rAbPurposeAnti-VGlut1 (Rat) chimeric recombinant antibody. The hybridoma-derived heavy chain variable sequence and kappa light chain are fused to a rabbit IgG Fc.DepositorRecommended ApplicationsWestern BlotReactivityRatSource SpeciesRabbitIsotypeIgGTrial SizeAvailable to purchaseAvailable SinceMarch 24, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits