We narrowed to 28,640 results for: tat
-
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pETDuet1-LanCL2-C321A/C367A-C-Ter-His
Plasmid#154188PurposeTo express LanCL2-C321A/C367A in bacterial cellsDepositorInsertLanCL2
TagsHexahistidineExpressionBacterialMutationCys321->Ala321; Cys367->Ala367Available SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSN554
Plasmid#177361PurposeExpresses human KIF1A(1-393) fused with leucine zipper, mScarlet and StrepII tagDepositorInsertKIF1A (KIF1A Human)
TagsLeucine zipper, StrepII tag, and mScarletExpressionBacterialPromoterT7Available SinceAug. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLPC-FLAG.Mm.EPC1.delta.EPcA
Plasmid#184655PurposeRetroviral expression of mouse EPC1 delta EPcADepositorInsertEpc1 (Epc1 Mouse)
UseRetroviralTagsFLAGExpressionMammalianMutationepc1 delta EPcAPromoterCMVAvailable SinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
HIS_TEV_hsSYX3
Plasmid#179290PurposeE. coli expression plasmid (T7lac promoter) for expression-optimized DNA of human Syx (aa 393-792) with N-terminal His6 + TEV protease cleavage siteDepositorInsertSyx
TagsHis6 + TEV protease cleavage siteExpressionBacterialMutationresidues 393-792 from accession number NP_0010361…PromoterT7lacAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
TKIT NFL gRNA1 gRNA2
Plasmid#182681PurposeExpression of spCas9, gRNA targeting intron 3 and gRNA targeting 3'UTR of the mouse Nefl gene. Can be used for the tagging of endogenous NFL via Targeted Knock-In with Two guides (TKIT) approach.DepositorInserttwo Nefl-targeting gRNAs, one targets intron 3 and the other 3'UTR of the Nefl gene (Nefl Mouse)
UseCRISPRExpressionMammalianPromoterU6 and chicken beta-actin promoterAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLPC-Flag.Mm.Epc1-EPcA
Plasmid#184657PurposeRetroviral expression of mouse Epc1 EPcADepositorInsertEpc1 (Epc1 Mouse)
UseRetroviralTagsFLAGExpressionMammalianMutationEpc1-EPcAPromoterCMVAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLPC-MYC.Mm.DMAP1
Plasmid#184651PurposeRetroviral expression of mouse Dmap1DepositorAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLPC-FLAG.Mm.EPC1.delta.EPcC
Plasmid#184656PurposeRetroviral expression of mouse EPC1 delta EPcCDepositorInsertEpc1 (Epc1 Mouse)
UseRetroviralTagsFLAGExpressionMammalianMutationEpc1 delta EPCc.QTPromoterCMVAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
3020_pETcon-SARS-CoV-2-RBD_N501Y
Plasmid#184405Purposeyeast surface display of the SARS-CoV-2 Alpha variant RBDDepositorInsertSARS-CoV-2 Alpha Spike receptor binding domain (RBD) (S SARS-CoV-2 virus)
TagsHA and c-MycExpressionYeastMutationN501YAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-TRR-C421-G2304D
Plasmid#182845Purposemutation G2304D (GGC/GAC), PCR product coding C-terminal residues 2011-2431 of TRR was inserted into modified pGEX-2T by Nde I-Nsi I sitesDepositorAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459_GRHL1-exon8
Plasmid#177764PurposesgRNA for CRISPR/Cas9-mediated deletion of human GRHL1DepositorInsertGRHL1 (GRHL1 Human)
UseCRISPRAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pnEA-NpH-HsNot9_19-285-V181E_AE
Plasmid#148617PurposeBacterial Expression of HsNot9_19-285-V181EDepositorInsertHsNot9_19-285-V181E (CNOT9 Human)
ExpressionBacterialAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmAGO2-RC_B
Plasmid#145981PurposeInsect Expression of DmAGO2-RCDepositorInsertDmAGO2-RC (AGO2 Fly)
ExpressionInsectMutationA deletion of AA 51-56 and an insertion of 23 AA …Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-E23K_B
Plasmid#145982PurposeInsect Expression of DmTral-E23KDepositorInsertDmTral-E23K (tral Fly)
ExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-R21E_B
Plasmid#145987PurposeInsect Expression of DmTral-R21EDepositorInsertDmTral-R21E (tral Fly)
ExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral_97-543-V5His6_D
Plasmid#146128PurposeInsect Expression of DmTral_97-543DepositorInsertDmTral_97-543 (tral Fly)
ExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral_97-652_D
Plasmid#146133PurposeInsect Expression of DmTral_97-652DepositorInsertDmTral_97-652 (tral Fly)
ExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-R21EE23K_C
Plasmid#146056PurposeInsect Expression of DmTral-R21EE23KDepositorInsertDmTral-R21EE23K (tral Fly)
ExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmTral-R21EE23KS13AI15A_C
Plasmid#146057PurposeInsect Expression of DmTral-R21EE23KS13AI15ADepositorInsertDmTral-R21EE23KS13AI15A (tral Fly)
ExpressionInsectMutationtwo silent mutations A198C, A387G and a mutation …Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only