We narrowed to 18,123 results for: multi
-
Plasmid#203803PurposeLentiviral vector plasmid expressing human RAB10 mutation Q68L (constitutively active mutant) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJuly 24, 2023AvailabilityAcademic Institutions and Nonprofits only
-
FLAG-dCas13b-ADAR2DD
Plasmid#190913PurposeAddgene #103871 with 3x FLAG on N-terminal of dCas13DepositorInsert3X FLAG
UseCRISPRTags3X FLAGExpressionMammalianPromoterCMVAvailable SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnEA-vH_His-TEV-SEPT2-sfCherry2_SEPT6
Plasmid#180313Purposebacterial co-expression of human SEPT2 fused to superfolder Cherry2 and of human SEPT6DepositorTagsHis6-TEV and sfCherry2ExpressionBacterialAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-MND-HsMAN1C1-1-630-cMycFlag-hPGK-GFP
Plasmid#183505PurposeExpress GFP and MAN1C1 proteinsDepositorInsertsUseLentiviralTagsMyc-DDKExpressionMammalianPromoterMND and hPGKAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
mVenus-NES-SspB-LARG-DH-P2A-iLIDcaax
Plasmid#173863PurposeMammalian expression of mVenus-NES-SspB-LARG-DH-P2A-iLIDcaax (opto-RhoA)DepositorInsertmVenus-NES-SspB-LARG-DH-P2A-iLIDcaax
TagsC-terminal CAAX-box and mVenusExpressionMammalianPromoterCMVAvailable SinceSept. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
AttB_[Kozak-mut]ACE2_IRES-mCherry-H2A-P2A-PuroR
Plasmid#171595PurposeWeak human ACE2 abundance from Bxb1 landing padDepositorInsertsUseSynthetic Biology; Promoterless bxb1 dna recombin…ExpressionMammalianAvailable SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-Necl-5-ScNeo
Plasmid#170283PurposeTo monitor the status of Necl-5, the plasmid encodes a recombinant Necl-5 fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInserta recombinant mouse Necl-5 fused to the mScarlet and to the mNeonGreen fluorescent protein (Pvr Mouse, Synthetic)
TagsmScarlet and mNeonGreenExpressionMammalianAvailable SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBR322-bom
Plasmid#155178PurposepBICI_2_strong without bom siteDepositorInsertsSucrose Phosphorylase from Bifidobacterium adolescentis (BAD_RS00415 Bifidobacterium adolescentis)
Cellobiose phosphorylase from Cellulomonas uda
UseSynthetic BiologyTagsHis Tag and Strep - Tag IIExpressionBacterialAvailable SinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPB-tetpA-hNEUROG2-iRPT
Plasmid#140764PurposeExpresses iRFP713, PuroR and rtTAM2 in mammalian cells, with TRE-hNEUROG2DepositorInsertsExpressionMammalianAvailable SinceJuly 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
SMT205
Plasmid#134817PurposeSMT201 with mutated RBS for DHFR, in vivo assaysDepositorInsertsDihydrofolate reductase
Thymidylate synthase
ExpressionBacterialMutationSilent mutations to eliminate internal restrictio…PromoterT7 and TETAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
Anti-TRIP8b (constant) [N212/17R]
Plasmid#114557PurposeMammalian Expression Plasmid of anti-TRIP8b (constant) (Rat). Derived from hybridoma N212/17.DepositorInsertanti-TRIP8b (constant) (Rattus norvegicus) recombinant mouse monoclonal antibody (Pex5l Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Puro DEST (w118-1) MXRA7
Plasmid#107500PurposeExpresses MXRA7, puromycin resistantDepositorInsertMXRA7 (codon optimized) (MXRA7 Human)
UseLentiviralExpressionMammalianMutationCodon optimized sequencePromoterCMVAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
Anti-Ataxin-1, 11NQ [N76/3R]
Plasmid#114559PurposeMammalian Expression Plasmid of anti-Ataxin-1, 11NQ (Mouse). Derived from hybridoma N76/3.DepositorInsertanti-Ataxin-1, 11NQ (Mus musculus) recombinant mouse monoclonal antibody (Atxn1 Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceSept. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
p.UTA.2.0 miR-27a-3p 3 perfect copies.
Plasmid#82439PurposeDual Fluorescent endogenous miRNA sensor. Perfect complementary region of hsa-miR-27a-3p in three copiesDepositorInserthsa-miR-27a-3p (MIR27A Human)
MutationThree copies hsa-miR-27a-3p Complementary region …Available SinceMarch 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
Cenp-B DBD INCENP TSS/AAA mCherry
Plasmid#45234PurposeTarget INCENP (with TSS mutated to AAA) to centromeres via CENP-B DNA binding domain (DBD)DepositorInsertCenp-B DBD, INCENP-ΔCEN with AAA mutation, mCherry
TagsCENP-B DBD, DNA binding domain of CENP-B and mChe…ExpressionMammalianMutationINCENP C-terminal TSS mutated to AAAPromotert7Available SinceSept. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJH104
Plasmid#48262PurposeTemplate plasmid for PCR-based transplant of Saccharomyces cerevisiae TEF1 promoter in yeast.DepositorInsertsTEF1p 5' fragment
URA3 5' fragment
TEF1p 3' fragment
UseRoutine cloning vectorMutationFrom SK1 background. -343 to -1 relative to TEF1 …PromoterTEF1pAvailable SinceFeb. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET28-a(+)-6xHis-miRFP(-5)-HO1
Plasmid#219424PurposeFluorescent protein to reconstruct the mixture that mimics the charge profile of E. coli lysateDepositorInsertsmiRFP682
HO1
TagsMGHHHHHGGExpressionBacterialMutationContains Ribosomal Binding Site for expression of…PromoterT7Available SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-RVR-A3A-Y130F
Plasmid#193658PurposeExpression of base editor RVR-A3A-Y130F in mammalian cells for base editing, along with non-fused EGFP fluorescenceDepositorInsertRVR-dLbCas12a-hA3A-Y130F, EGFP
ExpressionMammalianMutationdLbCas12a-G532R/K538V/Y542R, hAPOBEC3A-Y130FPromoterCMVAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-RVR-A3A-N57G
Plasmid#193657PurposeExpression of base editor RVR-A3A-N57G in mammalian cells for base editing, along with non-fused EGFP fluorescenceDepositorInsertRVR-dLbCas12a-hA3A-N57G, EGFP
ExpressionMammalianMutationdLbCas12a-G532R/K538V/Y542R, hAPOBEC3A-N57GPromoterCMVAvailable SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only