We narrowed to 16,688 results for: GRN
-
Plasmid#176669PurposeExpression of sgRNA under C. quinquefasciatus U6 (CPIJ039596) promoter & delivery of D.mel-Actin5C::EBFP2-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pLib6.4-Aalb_726
Plasmid#176661PurposeExpression of sgRNA under Ae. albopictus U6 (AALF029726) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Aaeg_763
Plasmid#176658PurposeExpression of sgRNA under Ae. Aegypti U6 (AAEL017763) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site3 (RTW549)
Plasmid#160138PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #3DepositorInsertAsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
5xtetO (tet3) Gene Desert
Plasmid#131339PurposegRNA to insert 5xTet operator sequence into a gene desert on chromosome 5.DepositorInsertDesert-gRNA
UseCRISPRExpressionMammalianAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330_sgACTA2
Plasmid#63712PurposeExpress sgACTA2 in mammalian cells.DepositorAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
MTK0_001
Plasmid#123924PurposeEncodes the spCas9 gRNA GFP dropout expression cassette with ConLS and ConRE connectors with Ampicillin resistance as a type 0 part to be used in the MTK systemDepositorInsertTU-sgRNA - L1/RE
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Cacnb2-GFP KI
Plasmid#139661PurposeEndogenous tagging of CaVβ2: C-terminal (amino acid position: Q655)DepositorInsertgRNA and GFP donor
ExpressionMammalianPromoterU6 and CbhAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
MTK234_055
Plasmid#123920PurposeEncodes the spCas9 gRNA GFP dropout expression cassette (bovine u6 promoter and constant region 2) as a type 234 part to be used in the MTK systemDepositorInsertgRNA-GFPDROPOUT-for Sp Cas9 bu6_20N_cr2
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET-FLAG-eSpCas9
Plasmid#126769PurposeExpression of increased fidelity eSpCas9 in bacterial cellsDepositorInserteSpCas9
UseCRISPRTags3xFLAG, 6xHis, MBP, and NLSExpressionBacterialMutationK848A, K1003A, R1060APromoterT7Available SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLP110_AAV Scramble Control
Plasmid#239418PurposeNegative control AAV vector for SaCas9-based CRISPR KODepositorInsertScramble control
UseAAVAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
LLP1014
Plasmid#239936PurposeHsp18.2 (heat inducible) promoter driving the expression of sgRNA-BDepositorInsertHsp18.2::sgRNA-B
UseSynthetic BiologyExpressionPlantMutationN/AAvailable SinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
Px-PhiYFP-triplex-28-M13-28-pA
Plasmid#202047PurposeEncodes PhiYFP downstream of a cloning site for constructing a synthetic Cas-targeted promoter. 3’ UTR has a MALAT1 triplex, Csy4 28nt sites, and cloning site for gRNA to activate downstream targets.DepositorInsertPhiYFP
ExpressionMammalianAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458-SLC35A1
Plasmid#239952PurposeEncodes gRNA for human SLC35A1DepositorInsertSLC35A1
UseCRISPRExpressionMammalianAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458-MFSD6
Plasmid#239951PurposeEncodes gRNA for human MFSD6DepositorInsertMFSD6
UseCRISPRExpressionMammalianAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT16
Plasmid#223388PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for monocot plants; NGG PAM; wide working window; A3A/Y130F-CBE_V01 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter.DepositorInsertZmUbi-hA3A-Y130F-SpCas9-D10A-UGI-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458-MYADM
Plasmid#235245PurposeEncodes gRNA for human MYADMDepositorAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT26
Plasmid#223398PurposeT-DNA vector for PmCDA1-CBE_V04 based C-to-T base editing for dicot plants; NGG PAM; 5' editing window; PmCDA1-CBE_V04 was driven by ZmUbi1 and the sgRNA was driven by AtU3; BASTA for plants select.DepositorInsertZmUbi-SpCas9D10A-PmCDA-UGI-T2A-MS2-UGI-AtU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT29
Plasmid#223401PurposeT-DNA vector for PmCDA1-CBE_V04 based C-to-T base editing for monocot plants; NGG PAM; 5' editing window; PmCDA1-CBE_V04 was driven by ZmUbi1 and the sgRNA was driven by OsU3; BASTA for plant select.DepositorInsertZmUbi-SpCas9D10A-PmCDA-UGI-T2A-MS2-UGI-OsU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT30
Plasmid#223402PurposeT-DNA vector for PmCDA1-CBE_V04 based C-to-T base editing for monocot plants; NGG PAM; 5' editing window; PmCDA1-CBE_V04 and the sgRNA was driven by separate ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-SpCas9D10A-PmCDA-UGI-T2A-MS2-UGI-ZmUbi-gRNA scaffold 2.0-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only