We narrowed to 70,507 results for: TOR
-
Plasmid#110169PurposeDominant negative effect by competing with MyosinVa C-terminal tail interactionsDepositorInsertMyosin Va (Myo5a Mouse)
TagsEGFP and MycExpressionMammalianMutationamino acids 1444-1853PromoterCMVAvailable SinceMay 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMOD_D-AtUBI10-NbGP41-sfGFP-VP64-GB1
Plasmid#202012PurposeMoclo level 1 - Module D, Promoter: AtUBI10, Gene: NbGP41P-sfGFP-VP64-GB1, Terminator: pea rbcsE9DepositorInsertNbGP41-sfGFP-VP64-GB1
UseSynthetic Biology; Moclo level 1 vectorTagsGB1 and sfGFPPromoterAtUBI10Available SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMD19_STARR-seq_plants
Plasmid#117379PurposeSTARR-seq vector with 35s core promoter for transient expression in plant protoplastsDepositorTypeEmpty backboneTagsGFP derived from pMDC107ExpressionPlantPromoter35s core promoterAvailable SinceNov. 22, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR P2R-P3-EYFP
Plasmid#48351PurposeContributes the coding sequence for EYFP as the 3’-module during MultiSite Gateway-cloning of chimeric cDNAs encoding three-part fusion proteins.DepositorInsertEYFP
UseGateway CloningMutationContains a stop codon.PromoternoneAvailable SinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
p3xFLAG-CMV-Tlr4
Plasmid#27148DepositorInserttoll-like receptor 4 (Tlr4 Mouse)
Tags3x FLAGExpressionMammalianMutationNative signal peptide sequence (original amino ac…Available SinceJan. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pX330_VCL sgRNA / hSpCas9
Plasmid#172837PurposeMammalian expression of a sgRNA targeting the intron 21 (last intron) of VCL (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 21 of VCL under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-JEDI-1P-WPRE
Plasmid#202611PurposeDouble floxed genetically encoded voltage indicator (GEVI) JEDI-1P in AAV production vector expressed under the mammalian promoter (EF1a)DepositorInsertJEDI-1P
UseAAV and Cre/LoxExpressionMammalianPromoterEF1aAvailable SinceJune 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
[pSK467] pLJC5 HA-Depdc5
Plasmid#109343PurposeLenti-viral expression of HA-tagged wildtype Depdc5DepositorAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRSET mNG-GECO1
Plasmid#201933PurposeExpresses mNG-GECO1 indicator in bacteriaDepositorInsertmNeonGreenGECO1
TagsHIS tagExpressionBacterialAvailable SinceAug. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-GNPTAB
Plasmid#78108PurposeMammalian expression of human GNPTAB with C terminal myc tagDepositorAvailable SinceMay 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCSIIbsr-Eevee-ROCK-NES
Plasmid#209918PurposeA FRET biosensor for ROCK activityDepositorInsertEevee-ROCK-NES
UseLentiviralTagsECFP and YPetAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-D2s-L-Venus
Plasmid#19966DepositorInsertD2 short variant-monomeric Venus (DRD2 Aequorea Victoria, Human)
TagsFlag and monomeric VenusExpressionMammalianAvailable SinceJan. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
pVeBtA2
Plasmid#238987PurposeMammalian expression of bovine arrestin-2 long isoform with Venus N-terminal fusionDepositorAvailable SinceMay 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330_TOMM20 sgRNA / hSpCas9
Plasmid#172836PurposeMammalian expression of a sgRNA targeting the intron 4 (last intron) of TOMM20 (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 4 of TOMM20 under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
STAgR_Neo
Plasmid#102992PurposeCan be used as backbone for a STAgR reactionDepositorTypeEmpty backboneUseCRISPR; Pcr template for stagr vectorsPromoterU6Available SinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
PF4-bio-His
Plasmid#53411PurposeExpresses full-length Platelet factor 4 precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertPF4 (PF4 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGFP.N1-HDAC6.delta Buz
Plasmid#36190DepositorInsertHDAC6..delta Buz (HDAC6 Human)
TagsEGFPExpressionMammalianMutationDeletion of the C-terminal ub binding domain (BUZ…PromoterCMVAvailable SinceApril 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
pGEX-KG-Itch/2793
Plasmid#11434DepositorAvailable SinceApril 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
pGEX-gp78c/2767
Plasmid#11429DepositorAvailable SinceJuly 19, 2006AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only