We narrowed to 32,849 results for: crispr
-
Plasmid#134251PurposeLentivector encoding CRISPR-resistant Snrnp40DepositorInsertSnrp40 (Snrnp40 Mouse)
UseLentiviralExpressionMammalianMutationmutated coding sequence “gataactatgcgacgttgaa” to…PromoterEF1aAvailable SinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC6 (pP18(T)_B11-AVA4069)
Plasmid#239304PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC6DepositorInsertU6-driven sgRNA targeting EXOSC6 (EXOSC6 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC7 (pP18(T)_C4-AVA4066)
Plasmid#239305PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC7DepositorInsertU6-driven sgRNA targeting EXOSC7 (EXOSC7 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC8 (pP18(T)_B1-AVA4071)
Plasmid#239306PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC8DepositorInsertU6-driven sgRNA targeting EXOSC8 (EXOSC8 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC9 (pP18(T)_A7-AVA4072)
Plasmid#239307PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC9DepositorInsertU6-driven sgRNA targeting EXOSC9 (EXOSC9 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_DIS3 (pP18(T)_A5-AVA4073)
Plasmid#239308PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting DIS3DepositorInsertU6-driven sgRNA targeting DIS3 (DIS3 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_C1D (pP18(T)_B9-AVA4070)
Plasmid#239296PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting C1DDepositorInsertU6-driven sgRNA targeting C1D (C1D Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC2 (pP18(T)_C3-AVA4067)
Plasmid#239301PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC2DepositorInsertU6-driven sgRNA targeting EXOSC2 (EXOSC2 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC4 (pP18(T)_C11-AVA4065)
Plasmid#239302PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC4DepositorInsertU6-driven sgRNA targeting EXOSC4 (EXOSC4 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC5 (pP18(T)_B12-AVA4068)
Plasmid#239303PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC5DepositorInsertU6-driven sgRNA targeting EXOSC5 (EXOSC5 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-bleo-Merlin(dog)gRNA2
Plasmid#214824PurposeA knockout vector for dog Merlin.DepositorInsertA gRNA targeting the dog NF2(Merlin) gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgPlxnb2-CRISPRa-3-EF1a-LibVec
Plasmid#239596Purposeexpresses guide#3 to boost the expression of mouse Plxnb2, via CRISPRaDepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgPlxnb2-CRISPRa-1-EF1a-LibVec
Plasmid#239594Purposeexpresses guide#1 to boost the expression of mouse Plxnb2, via CRISPRaDepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgPlxnb2-CRISPRa-2-EF1a-LibVec
Plasmid#239595Purposeexpresses guide#2 to boost the expression of mouse Plxnb2, via CRISPRaDepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-hUbC-EGFP-sgRNA.FOXA1/A2/A3_CRISPRi
Plasmid#216166PurposeExpress the gRNAs for the human FOXA1/A2/A3-CRISPRiDepositorInsertUseLentiviralTagsEGFPPromoterphU6, ph7SK, phH1, pmU6Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgRipk1_#1-puro
Plasmid#231984PurposeKnockout mouse Ripk1DepositorInsertsgRNA with Cas9 with puromycin resistance (Ripk1 Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgRipk1_#2-puro
Plasmid#231983PurposeKnockout mouse Ripk1DepositorInsertsgRNA with Cas9 with puromycin resistance (Ripk1 Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2puro-E-cadherin(Canis)-exon1 6-28 gRNA
Plasmid#209922PurposeA knock-out vector for the dog CDH1DepositorInsertA gRNA targeting the dog CDH1 gene.
UseCRISPR and LentiviralAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
RPS4X sgRNA-3 lentiCRISPR v2-Blast plasmid
Plasmid#192233Purposelentiviral vector expressing sgRNA-3 targeting eIF3 binding site of RPS4X 5'UTRDepositorInsertsgRNA-3 targeting eIF3 binding site of RPS4X 5'UTR (RPS4X Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS15A sgRNA-5 lentiCRISPR v2-Blast plasmid
Plasmid#192230Purposelentiviral vector expressing sgRNA-5 targeting eIF3 binding site of RPS15A 5'UTRDepositorInsertsgRNA-5 targeting eIF3 binding site of RPS15A 5'UTR (RPS15A Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only