We narrowed to 14,522 results for: SHR
-
Plasmid#218524PurposesgRNA targeting human KIAA0141/DELE1DepositorInsertDELE1 (DELE1 Human)
UseCRISPR and LentiviralAvailable SinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro KIAA0141/DELE1_sg2
Plasmid#218525PurposesgRNA targeting human KIAA0141/DELE1DepositorInsertDELE1 (DELE1 Human)
UseCRISPR and LentiviralAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
PIKFYVE gRNA (BRDN0001148075)
Plasmid#76891Purpose3rd generation lentiviral gRNA plasmid targeting human PIKFYVEDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK4 gRNA (BRDN0001147987)
Plasmid#76075Purpose3rd generation lentiviral gRNA plasmid targeting human STK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIP5K1C gRNA (BRDN0001148198)
Plasmid#77665Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1CDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIP5K1C gRNA (BRDN0001145736)
Plasmid#77666Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1CDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RIPK1 gRNA (BRDN0001148444)
Plasmid#76533Purpose3rd generation lentiviral gRNA plasmid targeting human RIPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RIPK1 gRNA (BRDN0001149461)
Plasmid#76532Purpose3rd generation lentiviral gRNA plasmid targeting human RIPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgAAVS1(A)
Plasmid#85570PurposeExpresses sgRNA targeting human AAVS1 locusDepositorInsertadeno-associated virus integration site 1 (AAVS1 Human)
ExpressionMammalianAvailable SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
STK4 gRNA (BRDN0001149002)
Plasmid#76074Purpose3rd generation lentiviral gRNA plasmid targeting human STK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lenti_Actb HMEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97312PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. Lenti backbone.DepositorInsertActb HMEJ donor
UseLentiviral and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
PIKFYVE gRNA (BRDN0001148312)
Plasmid#76893Purpose3rd generation lentiviral gRNA plasmid targeting human PIKFYVEDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
OR2M4_Deletion_gRNA
Plasmid#195194Purposedual gRNAs for deletion of OR2M4 in a third generation Cas9 backbone with GFPDepositorInsertOR2M4 dual gRNA (OR2M4 Human)
ExpressionMammalianAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
PIP5K1C gRNA (BRDN0001145164)
Plasmid#77667Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1CDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMEL15
Plasmid#107921Purposenat based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-ANLN_sgRNA
Plasmid#183876PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and ANLN sgRNA for N-terminal tagging of anillin in human cells.DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-NCOA7g1 (BB22)
Plasmid#139457PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes puromycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: puroR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-NCOA7g2 (BB23)
Plasmid#139458PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes puromycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: puroR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only