We narrowed to 18,382 results for: URE
-
Plasmid#105960Purposetransgenesis, appears rather late, likely due to long RFP maturation time but is brighter than most other Ath5 constructDepositorAvailable SinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA3.2 mir-1-1 reporter hsa-mir-128-1
Plasmid#46675DepositorInserthsa-mir-128-1 (MIR128-1 Human)
UseRNAiTagsV5 and hsa-mir-1-1ExpressionMammalianPromoterCMVAvailable SinceJune 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3B-CDS
Plasmid#136045PurposeUPF3B shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GAAGCCTTGTTCCGATCTAAT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSL0721 (pDonor_L1-105)
Plasmid#130645PurposeEncodes a mini-transposon derived from V. cholerae Tn6677 CAST, with CmR cargo gene and shortened left end. Total transposon size = 933 bp.DepositorInsertVchCAST donor DNA (short L)
UseCRISPR; TransposonExpressionBacterialAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSL0376 (His-MBP-StrepII-TniQ)
Plasmid#130641PurposeExpresses V. cholerae CAST TniQ from a T7 promoter, with N-terminal His10-MBP-TEVsite-StrepII for purification.DepositorInsertVchTniQ
UseCRISPR; TransposonTagsHis10-MBP-TEVsite-StrepII on TniQExpressionBacterialPromoterT7Available SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKI-cjFOXL2-coemiRFP670-PGK-Puro
Plasmid#186168PurposeKnock-in gene targeting in marmoset cells at FOXL2 locusDepositorInsertemiRFP670
UseMarmoset targetingMutationhuman codon-optimizedAvailable SinceNov. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pProEX-Af2Sir2
Plasmid#8380DepositorTagsHisExpressionBacterialAvailable SinceDec. 4, 2007AvailabilityAcademic Institutions and Nonprofits only -
PHKG2_HUMAN_D0
Plasmid#79736PurposeThis plasmid encodes the kinase domain of PHKG2. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
VRK2_HUMAN_D0
Plasmid#79737PurposeThis plasmid encodes the kinase domain of VRK2. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET15b-ITPA
Plasmid#60824Purposeto purify human ITPA from bacteriaDepositorAvailable SinceMarch 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_SORBS1-1/3
Plasmid#91547PurposeProtein expression and purification of human SH3 domain construct SORBS1-1/3DepositorInsertSORBS1-1/3 (SORBS1 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_SORBS1-3/3
Plasmid#91553PurposeProtein expression and purification of human SH3 domain construct SORBS1-3/3DepositorInsertSORBS1-3/3 (SORBS1 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_SORBS1-2/3
Plasmid#91530PurposeProtein expression and purification of human SH3 domain construct SORBS1-2/3DepositorInsertSORBS1-2/3 (SORBS1 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSBK.009
Plasmid#187209PurposeExpresses retron Eco1 ncRNA v35 (long a1/a2, barcode 1 [CCT-AGG]), and Cas1 + Cas2DepositorInsertsRetron Eco1 ncRNA v35 (long a1/a2, barcode 1 [CCT-AGG])
Cas1 + Cas2
UseSynthetic BiologyExpressionBacterialPromoterT7/LacAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSL0715 (pDonor_R1-57)
Plasmid#130644PurposeEncodes a mini-transposon derived from V. cholerae Tn6677 CAST, with CmR cargo gene and shortened right end. Total transposon size = 910 bp.DepositorInsertVchCAST donor DNA (short R)
UseCRISPR; TransposonExpressionBacterialAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEF1α-squirrel-monkey-CHMP3(155)-HA
Plasmid#154173Purposeexpresses squirrel monkey CHMP3(155) in mammalian cellsDepositorInsertCHMP3(155)
TagsHAExpressionMammalianMutationC-terminal truncation of CHMP3 at amino acid 155PromoterEF1-alphaAvailable SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
DsRed +9e
Plasmid#191766PurposeExpression of DsRed fused to a positively charged polypeptide (2 x KSG) . Overall charge on tetramer: +9eDepositorInsertDsRed
TagsN terminal fusion of positively charged polypetod…ExpressionBacterial and MammalianPromoterCMVAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 mir-1-1 reporter hsa-mir-92a-1
Plasmid#46672DepositorInserthsa-mir-92a-1 (MIR92A1 Human)
UseRNAiTagsV5 and hsa-mir-1-1ExpressionMammalianPromoterCMVAvailable SinceJuly 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
MSCV-miR30_shBrd9_1116-PGK-NeoR-IRES-mCherry
Plasmid#75133PurposeRetroviral expression plasmid encoding shBrd9_1116 (targeting murine Brd9)DepositorInsertshBrd9_1116
UseRetroviralAvailable SinceMay 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
eGFP-pk-H302A
Plasmid#115618PurposeExpresses human Parkin H302A in mammalian cellsDepositorAvailable SinceOct. 2, 2018AvailabilityAcademic Institutions and Nonprofits only