We narrowed to 17,149 results for: tes
-
Plasmid#249681PurposeExpresses human TOP3B (wildtype) with a C-terminal 3xFLAG tagged in mammalian cellsDepositorAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only
-
pBOB-Mrap2-P2A-Mc4r-HA
Plasmid#245991PurposeStimultaneously express HA C-terminal tagged mouse MC4R and untagged MRAP2 protein using a P2A linker, transiently via transfection or stably via lentivirus-mediated infection in mammalian cells.DepositorAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-AHR-shRNA3
Plasmid#166909PurposeLentivirus for inducible knockdown of human AHRDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Tnnt2 -Atp2a2-HA
Plasmid#227804Purposecardiomyocytes-specific plasmid with Tnnt2 promotor, expressing the coding sequence of mouse Atp2a2 and a HA tagDepositorAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA905 - KLF4 Puro-T2A-BFP (pRCA847 backbone)
Plasmid#238185PurposeLentiviral vector for overexpression KLF4 ORF from a EF1a promoterDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA881 - KLF4 Puro-T2A-GFP (pRCA847 backbone)
Plasmid#238182PurposeLentiviral vector for overexpression KLF4 ORF from a EF1a promoterDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
GB4080
Plasmid#215249PurposeModule for the constitutive expression of EGFP, p19 and the N. nambi luminescence pathway genes fused to a SF.DepositorInsertSF-EGFP-p19-LUZ-H3H-HISPS-CPH
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
HaloTag-LacI-KRAB
Plasmid#232638Purposelac repressor (LacI) which binds lacO sites; labeled with HaloTag and coupled with Krüppel-associated box (KRAB) repressorDepositorInsertHaloTag-LacI-KRAB
TagsNLSExpressionMammalianMutationnonePromoterCMVAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
NL4-3Δ6-drEGFP-IRES-mThy1.2
Plasmid#207881PurposeHIV reporter vector expressing dGFP and mThy1.2 from Env locusDepositorInsertdestabilized EGFP-IRES-mThy1.2
UseLentiviralPromoter5' lentiviral LTRAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCHW100002
Plasmid#222440PurposeLevel 0, CDS module (AATG-GCTT) containing rice OsL5.DepositorInsertOsL5 (Oryza sativa)
UseSynthetic BiologyExpressionPlantMutationBsaI/BbsI sites removed by point-mutationAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAS3-rig-3P::AI::lgc-47::SL2::GFP::unc-54-3'UTR
Plasmid#225924PurposeExpressing LGC-47 in AVA neuronDepositorAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDGB3_alpha2_4xCBS-mDFR-Rep-RepA-tNOS (GB3625)
Plasmid#225433PurposeTranscriptional unit for copper-regulation of BeYDV Rep/RepA with 4xCBS domain+minimal promoter DFR for induction by copper.DepositorInsert4xCBS:mDFR:Rep/RepA:Tnos
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
GB4542
Plasmid#215261PurposeModule for the expression of the N. nambi HISPS gene under the regulation of the copper inducible CBS4x:mDFR promoter and TNOS and the constitutve expression of CPH, LUZ, H3H, EGFP and p19DepositorInsertCBS4x:mDFR:HISPS-SF-CPH-SF-LUZ-H3H-EGFP-p19
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX-UBC_NKX2-1
Plasmid#221495PurposeNKX2-1 short isoform lentiviral overexpression using UBC promoterDepositorAvailable SinceJuly 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX-hPGK_NKX2-1
Plasmid#221494PurposeNKX2-1 short isoform lentiviral overexpression using hPGK promoterDepositorAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
GB4401
Plasmid#215252PurposeModule for the expression of the N. nambi HISPS gene under the regulation of PNOS and TNOS and the constitutive expression of CPH, LUZ, H3H, EGFP and p19.DepositorInsertSF-PNOS:HISPS:TNOS-CPH-LUZ-H3H-EGFP-p19
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPbHiT_3xmyc_hsp70UTR_hdhfr/yfcu
Plasmid#216421PurposeEmpty backbone to express gene specific gRNA and carry the homology repair template for CRISPR editing of Plasmodium berghei using the PbHiT system.DepositorTypeEmpty backboneUseCRISPR; Expression in plasmodium bergheiTags3xmycExpressionBacterialAvailable SinceApril 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPbU6_hdhfr/yfcu
Plasmid#216422PurposeEmpty backbone to express gene specific gRNA from the Plasmodium berghei U6 promoter for traditional CRISPR editing.DepositorTypeEmpty backboneUseCRISPR; Expression in plasmodium bergheiExpressionBacterialAvailable SinceApril 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
12URA-B-ScTop2∆CTD
Plasmid#214924PurposeYeast expression vector 6xHisTag-TEV at N terminus to express S cerevisiae topoisomerase II (1–1177)DepositorInserttopoisomerase II
Tags6x His-TEVExpressionYeastMutationDeleted amino acids 1178-1428PromoterGal 1/10Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only