We narrowed to 23,671 results for: CRISPR
-
Plasmid#73421PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 4F2.DepositorInsertPromoter 4F2 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP4F2 (orthogonal T7-lac variant)Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-CLTC
Plasmid#227313PurposeDonor template for mStayGold insertion into the C-terminus of the CLTC locus. For clathrin heavy chain visualization. To be co-transfected with sgRNA px330-PITCh-CLTC (Addgene #227312)DepositorInsertCLTC Homology Arms flanking a mStayGold Tag (CLTC Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJSC270 - Bacterial expression plasmid for SpCas9 eSpCas9(1.1)-HF1 variant
Plasmid#101217PurposeBacterial expression plasmid for SpCas9 eSpCas9(1.1)-HF1 variantDepositorInsertSpCas9 variant K848A/K1003A/R1060A/N497A/R661A/Q695A/Q926A
Tags10x His, MBP, and TEV siteExpressionBacterialMutationK848A, K1003A, R1060A, N497A, R661A, Q695A and Q9…PromoterT7Available SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
Cas12f-GE ver3.0
Plasmid#176508PurposeExpresses Cas12f-GE in mammalian cellsDepositorInsertsCas12f-GE ver3.0
Cas12f-GE ver3.0
ExpressionMammalianPromoterU6 and chicken β-actinAvailable SinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEJS1005-Lenti-mammalian c.o.AcrIIA5-FLAG-NLS-HygR
Plasmid#136514PurposeExpresses type II-A anti-CRISPR protein AcrIIA5 in mammalian cells in a lentiviral vectorDepositorInsertCodon-optimized AcrIIA5
UseLentiviralTagsFLAG/NLSExpressionMammalianPromoterSFFVAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
plenti-px330-CRBN-T2-pGK-Pur
Plasmid#107383PurposeMammalian expression CRISPR/Cas9DepositorAvailable SinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP308-pAAV-EFS-dSaCas9-VP64-Dio-pA
Plasmid#113685PurposeAn EFS driven inverted de-catalyzed SaCas9 fused to the transcription activator VP64. dSaCas9-VP64 is floxed to render the system cre-dependent.DepositorInsertinverted de-catalyzed SaCas9
UseAAV, CRISPR, Cre/Lox, and Synthetic BiologyTagsNLS and VP64Available SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLex_Cas9
Plasmid#117987PurposepLex_Cas9 is a single insert lentiviral vector expressing Cas9 driven by CMV promoter.DepositorInsertCas9-P2A-NLS-BASTR
UseLentiviralTagsP2A linker, nuclear localization signal and blast…Available SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
AA025
Plasmid#216005PurposeFragmid fragment: (Cas protein) NG PAMDepositorHas ServiceCloning Grade DNAInsertCas9-NG_v1.1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA145
Plasmid#215937PurposeFragmid fragment: (guide cassette) guide expression; Chen F+E trRNA (preferred)DepositorHas ServiceCloning Grade DNAInsertU6_v1; BsmBI_v0; BsmBI_v1; trRNA_v4 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-NL-DHFR-SpCas9
Plasmid#124522PurposeExpresses SpCas9 fused to DHFR domains on both the N-terminus and an internal loop in mammalian cellsDepositorInsertNL-DHFR-SpCas9
UseAAVTagsDestabilized domain of E.coli dihydrofolate reduc…ExpressionMammalianPromoterCbhAvailable SinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
AA180
Plasmid#216023PurposeFragmid fragment: (Cas protein) NGRR(T) PAMDepositorHas ServiceCloning Grade DNAInsertCas9_v1.1 [Sa]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA027
Plasmid#216007PurposeFragmid fragment: (Cas protein) nearly PAM-lessDepositorHas ServiceCloning Grade DNAInsertCas9-SpRY_v1.1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA026
Plasmid#216006PurposeFragmid fragment: (Cas protein) NG PAMDepositorHas ServiceCloning Grade DNAInsertCas9-SpG_v1.1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha2 P35S:dCas9:VPR:Tnos (GB1826)
Plasmid#160623PurposeTU for the constitutive expression of dCas9 fused to VPR (VP64-p65-Rta) activation domainsDepositorInsertP35S:dCas9:VPR-Tnos
ExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
Pblu-AAVS1-Cas9-p300-M2rtTA-AAVS1
Plasmid#112261PurposeDonor plasmid with a Cas9-p300 expression cassette, a M2rtTA expression cassette, a T2A-puro selection cassette, and two gRNA recognition sequences at both ends of the whole insertion DNA fragment.DepositorInsertspCas9-p300 (EP300 Human, Synthetic)
ExpressionMammalianAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
eA3A-BE3 (pRZ206)
Plasmid#131315PurposeCAG promoter expression plasmid for hA3A(N57G)-XTEN linker-hSpCas9n(D10A)-UGI-NLS-P2A-EGFP.DepositorInserthA3A(N57G)-XTEN linker-hSpCas9n(D10A)-UGI-NLS-P2A-EGFP
ExpressionMammalianPromoterCAGAvailable SinceOct. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJZC620
Plasmid#62282PurposeExpresses dCas9, MCP-VP64, and PCP-VP64 in Yeast cellsDepositorInsertsMCP-VP64
PCP-VP64
dCas9
TagsVP64ExpressionYeastMutationNuclease activity has been inactivated by mutatio…PromoterpAdh and pTdh3Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-ultraID-LMNB1
Plasmid#207775PurposeDonor template for Blast-2A-ultraID insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-ultraID Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits