We narrowed to 28,641 results for: Tat

#75506

3rd generation lentiviral gRNA plasmid targeting human INSR

John Doench, David Root

Doench et al Nat Biotechnol. 2016 Jan 18. doi: 10.103

July 6, 2016

Academic Institutions and Nonprofits only

#184407

yeast surface display of the SARS-CoV-2 Delta variant RBD

Jesse Bloom

Starr et al Science. 2022 Jun 28:eabo7896. doi: 10.1

May 23, 2022

Academic Institutions and Nonprofits only

#87409

p426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#128841

gRNA for targeting mouse Esrrb locus using CRISPR-cas technique

Yossi Buganim

Benchetrit et al Cell Stem Cell. 2019 Jun 6;24(6):983-994

Aug. 27, 2019

Academic Institutions and Nonprofits only

#131714

Mammalian Expression of Flag tagged BRAF

Jacques De Grève

Noeparast et al Oncotarget. 2016 Aug 26;8(36):60094-6010

July 26, 2022

Academic Institutions and Nonprofits only

#77468

3rd generation lentiviral gRNA plasmid targeting human TGFBR2

John Doench, David Root

Doench et al Nat Biotechnol. 2016 Jan 18. doi: 10.103

July 6, 2016

Academic Institutions and Nonprofits only

#115342

Liver-specific adeno-associated viral delivery and mammalian expression of Flag-mRIPK1-S321A

Junying Yuan

Geng et al Nat Commun. 2017 Aug 25;8(1):359. doi: 1

Sept. 11, 2018

Academic Institutions and Nonprofits only

#98951

Mammalian expression plasmid for N-terminal myc-tagged human CXCR4 mutant W161Y

Erik Procko

Heredia et al J Immunol. 2018 Apr 20. pii: jimmunol.18

April 24, 2018

Academic Institutions and Nonprofits only

#98952

Mammalian expression plasmid for N-terminal myc-tagged human CXCR4 mutant W161H

Erik Procko

Heredia et al J Immunol. 2018 Apr 20. pii: jimmunol.18

April 24, 2018

Academic Institutions and Nonprofits only

#77287

3rd generation lentiviral gRNA plasmid targeting human TWF1

John Doench, David Root

Doench et al Nat Biotechnol. 2016 Jan 18. doi: 10.103

July 6, 2016

Academic Institutions and Nonprofits only

#166851

Expresses mutant E141D ATG5, HA-ATG12 ATG16 in yeast.

Daniel Klionsky

Kim et al Elife. 2016 Jan 26;5. pii: e12245. doi:

April 5, 2021

Academic Institutions and Nonprofits only

#115464

Constitutive lentiviral expression

William Hahn

Li et al Elife. 2018 Jul 30;7. pii: 37184. doi: 1

Oct. 2, 2018

Academic Institutions and Nonprofits only

#76622

3rd generation lentiviral gRNA plasmid targeting human DYRK1B

John Doench, David Root

Doench et al Nat Biotechnol. 2016 Jan 18. doi: 10.103

July 6, 2016

Academic Institutions and Nonprofits only

#163340

Retroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a Ly6G surface marker and an HA-tagged puromycin selection marker

Louis Ates, Teunis Geijtenbeek

van der Donk et al Biol Open. 2022 Feb 15;11(2):bio059032.

Jan. 27, 2021

Academic Institutions and Nonprofits only

#25746

Control lentiviral vector with Tet-based inducible expression of mouse G beta 2 miR30-based shRNA and GFP, constitutive Neomycin resistance gene coexpression.

Iain Fraser

Shin et al Proc Natl Acad Sci U S A. 2006 Sep 12. 1

July 1, 2010

Academic Institutions and Nonprofits only

#53567

Genetically encoded voltage sensor ArcLight with improved kinetics

Vincent Pieribone

Han et al PLoS One. 2013 Nov 27;8(11):e81295. doi:

Aug. 7, 2014

Academic Institutions and Nonprofits only

#98953

Mammalian expression plasmid for N-terminal myc-tagged human CXCR4 mutant H79Q

Erik Procko

Heredia et al J Immunol. 2018 Apr 20. pii: jimmunol.18

April 24, 2018

Academic Institutions and Nonprofits only