We narrowed to 84,770 results for: ell
-
Plasmid#84332PurposeCo-expresses (untagged) Histamine-3 receptor and mCherryDepositorAvailable SinceDec. 9, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pLenti-Blast PhLP1-myc-6xHis
Plasmid#218178PurposeUsed to make a lenti virus for stable expression of phosducin-like protein 1 in mammalian cellsDepositorInsertPhosducin like protein 1 (PDCL Human)
UseLentiviralTags6x His and MycExpressionMammalianAvailable SinceApril 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
UAS-dsarm(E)
Plasmid#187870PurposeGal4/UAS expression of dSarm(isoE)DepositorInsertdSarm isoform E (Sarm Fly)
Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-3xFLAG::Fnip1-pgk-hph
Plasmid#48758PurposePiggyBac backbone, CAG promoter driving murine 3xFLAG-Fnip1 fusion, Hygromycin selectionDepositorAvailable SinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.2/V5-DEST NET1A V5 WT
Plasmid#69817PurposeExpresses NET1A-V5 in mammalian cellsDepositorAvailable SinceApril 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE1-gRNA#2
Plasmid#107727PurposeKnock out of EB1 in human cells by CRISPR/Cas9DepositorAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMT-Pav-GFP
Plasmid#24286DepositorAvailable SinceJune 29, 2010AvailabilityAcademic Institutions and Nonprofits only -
pT2/GD-IRES-GFP-CTNNB1
Plasmid#192868PurposeCarries a Sleeping Beauty (SB) transposon vector that can be used to deliver an activated human CTNNB1(S33Y) transgene into cells, when a source of SB transposase is also co-introduced.DepositorInsertsluc+
EGFP
CTNNB1
ExpressionMammalianAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mNeon-Blast-TUBB4B
Plasmid#207786PurposeDonor template for mNeon-2A-Blast insertion into the C-terminus of the TUBB4B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBB4B Addgene #207785DepositorInsertTUBB4B Homology Arms flanking a mNeon-Blast Cassette (TUBB4B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7529 pHR (hU6-crLPT-EFS-PuroR-WPRE)
Plasmid#214877PurposeLentiviral vector encoding RfxCas13d targeting LPT guide arrayDepositorInserthU6-crLPT-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf48
Plasmid#12736PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf48
ExpressionMammalianAvailable SinceDec. 1, 2006AvailabilityAcademic Institutions and Nonprofits only -
AdMKP-3 S197A
Plasmid#131522PurposeExpresses MKP-3 with S197A mutation in mammalian cellsDepositorInsertMitogen-activated protein kinase phosphatase 3 (Dusp6 Mouse)
UseAdenoviralTagsNoMutationchanged Serine 197 to AlaninePromoterCMVAvailable SinceOct. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV dCas9-MC (eGFP)
Plasmid#89931PurposeExpresses the dCas9-MC fragment only of the sMTase system for targeted DNA methylation in mammalian cells. Contains a eGFP marker expressed off separate promoter.DepositorInsertdCas9-MC
TagsFlagExpressionMammalianMutationdeactivated Cas9, fragment of M.SssI (residues 27…PromoterCMVAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pJZC41
Plasmid#62332PurposesgRNA (no RNA aptamer addition) with PCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
PCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Puro-H2BC11-MMEJ
Plasmid#207760PurposeMMEJ donor template for moxGFP-2A-Puro insertion into the C-terminus of the H2BC11 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 Addgene #207755DepositorInsertH2BC11 Short Homology Arms flanking a moxGFP-Puro Cassette (H2BC11 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFastBac HT JS-Munc18b
Plasmid#135554PurposeExpress rat Munc18b in Sf9 cells, the resulted plasmid encodes an N-terminally His6-tagged Munc18c protein with a tobacco etch virus (TEV) cleavage site between the His6 tag and Munc18b.DepositorInsertMunc18b (Stxbp2 Rat)
Tags6xHis tag and TEV siteExpressionInsectPromoterpolyhedrin promoterAvailable SinceMarch 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-2-TGFBR2-m3_3'UTR
Plasmid#31883DepositorInsertTGFBR2 mutant 3'UTR (TGFBR2 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationThird miR-302b, 372 7-mer seed match mutated from…PromoterSV40Available SinceSept. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
ET1-human LRRC33
Plasmid#111603PurposeExpress human LRRC33 in 293T cellsDepositorAvailable SinceOct. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL-p21UTRm1
Plasmid#20878DepositorInsertp21 3'UTR site 1 mutation (Cdkn1a Mouse)
UseLuciferaseExpressionMammalianMutationPredicted miRNA binding site 1 (Position ~420) GC…Available SinceAug. 5, 2009AvailabilityAcademic Institutions and Nonprofits only