We narrowed to 1,758 results for: pyogenes Cas9
-
Plasmid#167688PurposeFinal destination vector for single Gateway LR reactionDepositorInsertpEC1.2::Cas9i
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRU323
Plasmid#167690PurposeFinal destination vector for single Gateway LR reactionDepositorInsertPcUBQ4-2::Cas9i
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRU292
Plasmid#167687PurposeFinal destination vector for single Gateway LR reactionDepositorInsertPcUBQ4-2::Cas9i
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRU52
Plasmid#167678PurposeFinal destination vector for single Gateway LR reactionDepositorInsertPcUB4-2::spCas9
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRU51
Plasmid#167677PurposeFinal destination vector for single Gateway LR reactionDepositorInsertPcUB4-2::spCas9
UseCRISPRAvailable SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 RFP670
Plasmid#187646Purposelentiviral vector expressing RFP670 alongside Cas9 and an sgRNA cloning siteDepositorInsertRFP 670
UseLentiviralTagsRFP670 and sgRNA cloning sitePromoterEFS (P2A)Available SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAS
Plasmid#60847PurposeExpresses S. pyogenes Cas9 plus an HDV ribozyme-sgRNA for genome editing in yeastDepositorInsertsS. pyogenese Cas9
RNA pol III promoter (tRNA-Tyr)
hepatitis delta virus ribozyme, genomic
sgRNA
UseCRISPR and Synthetic BiologyTagsNLS/His8 and TTT 3' extension prior to sgRNAExpressionBacterial and YeastMutationL4 is UUCG tetraloop and guide targets LYP1 (CATA…Available SinceJan. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAS1yl
Plasmid#73226PurposeConstitutive expression of Cas9 and sgRNA in Yarrowia lipolytica cellsDepositorInsertsCas9
sgRNA
UseCRISPR; In y. lipolyticaExpressionBacterialPromoterunknownAvailable SinceJune 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0202
Plasmid#185626PurposeMoClo Level 1, position 5 reverse, transcriptional unit for expression of plant codon optimized Cas9 from Streptococcus pyogenes driven by 35S promoterDepositorInsertSpCas9
UseCRISPR and Synthetic BiologyAvailable SinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0001
Plasmid#185625PurposeMoClo Level 1, position 2 reverse, transcriptional unit for expression of plant codon optimized Cas9 from Streptococcus pyogenes driven by 35S promoterDepositorInsertSpCas9
UseCRISPR and Synthetic BiologyAvailable SinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSc1
Plasmid#80436PurposeExpresses eGFP along with an U6 promoter driven gRNA which cleaves the plasmid in-cellDepositorInsertssp Cas9 gRNA
eGFP
UseCRISPRExpressionMammalianPromoterCMV and U6Available SinceAug. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSc2
Plasmid#80437PurposeExpresses eGFP along with an U6 promoter driven gRNA which cleaves the plasmid in-cellDepositorInsertssp Cas9 gRNA
eGFP
UseCRISPRExpressionMammalianPromoterCMV and U6Available SinceSept. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
iCas
Plasmid#84232PurposeExpression of SpCas9 with 4 ERT2 fusion protein and empty gRNA cassette. The activity of Cas9 can be switched on and off in human cells with 4-hydroxytamoxifen (4-HT)DepositorInsertCas9
Tags2A-OFP co-expression and ERT2-ERT2ExpressionMammalianPromoterCMVAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pML104
Plasmid#67638PurposeExpresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains URA3 marker for yeast transformationDepositorInsertsCas9
single guide RNA expression cassette
UseCRISPRExpressionYeastPromoterpSNR52 and pTDH3Available SinceAug. 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pML107
Plasmid#67639PurposeExpresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains LEU2 marker for yeast transformationDepositorInsertsCas9
single guide RNA expression cassette
UseCRISPRExpressionYeastPromoterpSNR52 and pTDH3 (aka GAP promoter)Available SinceAug. 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJH375
Plasmid#86841Purposemamalian expression of anti-CRISPR protein AcrIIA3DepositorInsertacrIIA3
ExpressionMammalianPromoterCMVAvailable SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT7sgRNA
Plasmid#111820PurposeExpresses sgRNA in T. brucei cellsDepositorInsertsgRNA
UseCRISPRAvailable SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCSW24
Plasmid#86837Purposebacterial expression of anti-CRISPR protein AcrIIA3DepositorInsertacrIIA3
ExpressionBacterialPromoteraraBADAvailable SinceOct. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
C113m
Plasmid#121012PurposeMoClo golden gate assembly CD part for Cas9 (S. pyogenes gRNA-targeted endonuclease Cas9). Please see Supplemental Documents for annotated Genbank file.DepositorInsertCas9
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only