We narrowed to 51,260 results for: des.1
-
Plasmid#149430PurposeminiTdg gene, catalytic mutantDepositorInsertTdg (Tdg Mouse)
UseCre/LoxExpressionMammalianMutationN151A catalytic mutant, SNPs of Tdg gene in OLA/1…PromoterTdg promoterAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
PCRII apoBb.1
Plasmid#121898PurposePlasmid for making zebrafish apoBb.1 in situ probeDepositorInsertApoBb.1 (apobb.1 Zebrafish)
UseUnspecifiedAvailable SinceMay 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_ITSN2-1/5
Plasmid#91497PurposeProtein expression and purification of human SH3 domain construct ITSN2-1/5DepositorInsertITSN2-1/5 (ITSN2 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_FCHSD2-1/2
Plasmid#91444PurposeProtein expression and purification of human SH3 domain construct FCHSD2-1/2DepositorInsertFCHSD2-1/2 (FCHSD2 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_FCHSD1-1/2
Plasmid#91449PurposeProtein expression and purification of human SH3 domain construct FCHSD1-1/2DepositorInsertFCHSD1-1/2 (FCHSD1 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_TRIO-1/2
Plasmid#91353PurposeProtein expression and purification of human SH3 domain construct TRIO-1/2DepositorInsertTRIO-1/2 (TRIO Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_ARHGEF37-1/2
Plasmid#91310PurposeProtein expression and purification of human SH3 domain construct ARHGEF37-1/2DepositorInsertARHGEF37-1/2 (ARHGEF37 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_CACNB2-1/2
Plasmid#91314PurposeProtein expression and purification of human SH3 domain construct CACNB2-1/2DepositorInsertCACNB2-1/2 (CACNB2 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1_puro_shNRF2-1
Plasmid#230086PurposeshRNA silencing human NRF2 geneDepositorInsertNrf2 (Nuclear factor-erythroid factor 2-related factor 2) (NFE2L2 Human)
UseLentiviral and RNAiExpressionMammalianAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
huCaV2.2 (pSAD442-1)
Plasmid#62574PurposeHuman CaV2.2 expression in mammalian cellsDepositorAvailable SinceMarch 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shNRF2 #1
Plasmid#136584PurposeExpresses an inducible short hairpin targeting human NRF2 sequenceDepositorAvailable SinceJune 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEX6p-1-UFBP1
Plasmid#204558PurposeExpresses GST-tagged UFBP1 in E.coliDepositorAvailable SinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shLuc.mKO2
Plasmid#85224PurposeshLuc (Target TTACGCTGAGTACTTCGA) for silencing luciferase gene as a control and express monomeric Kusabira-Orange2.DepositorInsertFirefly Luciferase
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_GRB2-1/2
Plasmid#91480PurposeProtein expression and purification of human SH3 domain construct GRB2-1/2DepositorInsertGRB2-1/2 (GRB2 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIRES:mTREK-1(G137I)
Plasmid#133274PurposeMammalian expression vector. It will generate the mouse TREK-1 channel full lenght G137I mutant fused to a N-terminal HA tagDepositorInsertPotassium channel subfamily K member 2 (KCNK2, TREK-1) (Kcnk2 Mouse)
TagsHAExpressionMammalianMutationG137IPromoterCMVd2Available SinceApril 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shDsup
Plasmid#90024PurposeTo establish Dsup knock down cellsDepositorInsertDsup
ExpressionMammalianAvailable SinceMay 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_MAP3K9-1/2
Plasmid#91313PurposeProtein expression and purification of human SH3 domain construct MAP3K9-1/2DepositorInsertMAP3K9-1/2 (MAP3K9 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shCcnb1
Plasmid#162793PurposeCcnb1 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only