We narrowed to 12,237 results for: nsf
-
Plasmid#125896PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA13Available SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
46_pAAV-ProC11-CatCh-GFP-WPRE
Plasmid#125946PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC11Available SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBIG1b_nsp7-Linker-nsp8 (SARS-CoV-2)
Plasmid#169181PurposeBaculoviral transfer vector to express untagged nsp7-Linker-nsp8 fusion protein (SARS-CoV-2) in insect cellsDepositorInsertnsp7-Linker-nsp8 (ORF1ab SARS-CoV-2, Synthetic)
TagsNo purification tag and nsp7-nsp8 fusion protein …ExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
11_pAAV-ProC6-CatCh-GFP-WPRE
Plasmid#125942PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC6Available SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 rtTA BirA eIF4G
Plasmid#158789PurposepcDNA5 based transfection plasmid for the exogenous expression of N-terminal BirA-Flag-tagged eIF4G1 lacking the microexon for generation of N2A FlpIn cell lines for BioIDDepositorInserteIF4G1
Tags3xFlag and BirA*ExpressionMammalianPromoterminiCMVAvailable SinceAug. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1270 - pAAV Rosa26 gRNA A+B EF1a EGFP
Plasmid#113156PurposeAn AAV vector that expresses guide RNAs targeting rat Rosa26 and expresses EGFP reporterDepositorInsertTwo gRNAs for rat Rosa26
UseAAV and CRISPRExpressionMammalianPromotermU6 and hU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-EHC
Plasmid#112619Purposeexpression plasmid with CAG promoter driving multicistronic cassette H2BEmerald_p2A_HygroR_p2A_CreERt2DepositorInsertsTagsVenusExpressionMammalianPromoterCAGAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEHC
Plasmid#112615Purposepromoterless expression plasmid driving multicistronic cassette H2BEmerald_p2A_HygroR_p2A_CreERt2DepositorInsertsUsePromoterless vector, ready for promoter for mamma…TagsEmeraldExpressionMammalianPromoterNo PromoterAvailable SinceOct. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmTHC
Plasmid#112616Purposepromoterless expression plasmid driving multicistronic cassette H2BmTeal_p2A_HygroR_p2A_CreERt2DepositorInsertsUsePromoterless vector, ready for promoter for mamma…TagsmTeal (mTFP1)ExpressionMammalianPromoterNo PromoterAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
40_pAAV-ProC9-CatCh-GFP-WPRE
Plasmid#125944PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC9Available SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
95_pAAV-ProA28-CatCh-GFP-WPRE
Plasmid#125911PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA28Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
61_pAAV-ProA18-CatCh-GFP-WPRE
Plasmid#125901PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA18Available SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
5_pAAV-ProA9-CatCh-GFP-WPRE
Plasmid#125893PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA9Available SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
214_pAAV-ProD22-CatCh-GFP-WPRE
Plasmid#125998PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProD22Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
159_pAAV-ProD3-CatCh-GFP-WPRE
Plasmid#125979PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProD3Available SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
Icam 2 SaCas9 YAP sgRNA3
Plasmid#99736PurposeExpresses SaCas9 and a gRNA targeting mouse YAPDepositorAvailable SinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ai14-luc
Plasmid#87118PurposeAAV backbone plasmid including luc-pA knock-in donor and Ai14gRNA for HITIDepositorInsertU6-Ai14sgRNA-Luciferase-nEF-GFPKASH-hGHpA
UseAAV, CRISPR, and LuciferaseAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SEPT_Cdk2-T160E-siR
Plasmid#73976PurposeHDR template to generate Cdk2-T160E-siRDepositorUseAAVMutationT160 mutated to Glu and siRNA target site mutatedAvailable SinceMarch 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEMS1593
Plasmid#29270PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle122 (ICMT Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceOct. 28, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits