We narrowed to 16,369 results for: gRNA
-
Plasmid#164804PurposeREDIT backbone for nickase Cas9n, pU6-MS2-gRNA-backbone(BbsI)-CBH-SpCas9n(D10A)-T2A-EGFPDepositorTypeEmpty backboneExpressionMammalianAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only
-
CROP_C9_Puro_FGFR3
Plasmid#183291PurposeAll-in-One CRISPRko system with a guide RNA that targets FGFR3 geneDepositorInsertFGFR3
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ135B2.0
Plasmid#167159PurposeGolden Gate entry vector to express the 5th gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU3Available SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGCP123-GFP_g1
Plasmid#153518PurposesgRNA to GFP gene (NT) under nisin-inducible nisA promoter, barcodedDepositorInsertPnisA-sgRNA(GFP_g1)_dCas9 scaffold (barcoded)
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO-shSmad4
Plasmid#37046DepositorAvailable SinceJan. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSUPER.ATMi
Plasmid#14581DepositorAvailable SinceMarch 27, 2007AvailabilityAcademic Institutions and Nonprofits only -
pYPQ144-ZmUbi-tRNA
Plasmid#158402PurposeGateway entry clone and Golden Gate recipient for pYPQ131-tRNA2.0 to pYPQ134-tRNA2.0; assembly of 4 gRNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterMaize ubiquitin 1Available SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-MOV10-ts1
Plasmid#174277PurposeMOV10 knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-MOV10-ts2
Plasmid#174278PurposeMOV10 knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 shFmnl2-EGFP
Plasmid#187255PurposeLentiviral expression of shRNA targeting Fmnl2DepositorAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKEE401
Plasmid#91715PurposeCRISPR/Cas9-mediated genome editing in Arabidopsis. Contains Cas9 and empty gRNA scaffold, Kan resistanceDepositorTypeEmpty backboneExpressionPlantAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-shRNA-Tet2
Plasmid#85743PurposeshRNA against mouse Tet2DepositorInsertshRNA Tet2
UseAAVTagsEYFPAvailable SinceJune 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPU-huTRIMmiR30-TRIM5
Plasmid#132938PurposeAll-in-one huTRIM5 rescue-TRIM5 shRNA knockdownDepositorInserthuman TRIM5
UseLentiviral and RNAiExpressionMammalianPromoterSFFVAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ136B2.0
Plasmid#167160PurposeGolden Gate entry vector to express the 6th gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU3Available SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS-puro shNEDD4L #1
Plasmid#27016DepositorAvailable SinceDec. 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
pQdCas9.luxR(mut)-sggfp
Plasmid#236185PurposeThe plasmid pQdCas9.luxR(mut)-sggfp expresses the dCas9 endonuclease and the sgRNA targeting the GFP gene. Additionally, this plasmid contains a mutation in the luxR gene.DepositorInsertQuorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas9, and sgRNA for GFP gene
PromoterQuorum sensing promoterAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
CRISPseq-mCherry-backbone
Plasmid#85708PurposeBackbone for CRISPR/Cas9 screening with single cell RNA-seq. Lentiviral plasmid for cloning of gRNAs and Unique Guide Index (UGI), with an mCherry fluorescent marker. Does NOT include Cas9.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-phsyn-FLEX-KASH-EGFP-U6-shRNA
Plasmid#129708PurposeExpress cre-dependent KASH-EGFP and scramble shRNADepositorInsertKASH-EGFP
UseAAVTagsEGFPExpressionMammalianPromoterU6Available SinceAug. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_HDAC2
Plasmid#183298PurposeAll-in-One CRISPRko system with a guide RNA that targets HDAC2 geneDepositorInsertHDAC2
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only