We narrowed to 29,147 results for: tat
-
Plasmid#100991PurposeContains model Rp51a with a GGTAtGT->tGTAtGa 5'SS mutant (SUS1 5'SS sequence).DepositorInsertRP51A (RPS17A Budding Yeast)
ExpressionBacterial and YeastMutationGGTAtGT->tGTAtGa 5'SS mutantAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRS426-GFP-COF1
Plasmid#31844DepositorAvailable SinceOct. 19, 2011AvailabilityAcademic Institutions and Nonprofits only -
pRS316-GFP-COF1
Plasmid#31843DepositorAvailable SinceOct. 19, 2011AvailabilityAcademic Institutions and Nonprofits only -
pmRuby2-IRES-Clover
Plasmid#171059PurposeExpresses mRuby2 and mClover2 in the cytoplasm as negative control for FRET.DepositorInsertIRES
ExpressionMammalianPromoterCMVAvailable SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMut12_apo64C
Plasmid#247072PurposeL-arabinose inducible rAPOBEC-XTEN64-CasC(Cas7)-GSSG-UGIDepositorInsertrAPOBEC-XTEN64-CasC-UGI
UseCRISPRExpressionBacterialAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSG5 PMS2-wt
Plasmid#16475DepositorInsertPMS2 (PMS2 Human)
ExpressionMammalianAvailable SinceMarch 12, 2008AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-USP10-CDS
Plasmid#136057PurposeUSP10 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CCTATGTGGAAACTAAGTATT)DepositorAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRL2960
Plasmid#70694PurposepDU1-E. coli shuttle vector (Km-r) with extended polylinkerDepositorTypeEmpty backboneUseBacterial shuttle vectorAvailable SinceNov. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRL2697
Plasmid#70693PurposepDU1-E. coli shuttle vector (Cm-r Em-r) with extended polylinkerDepositorTypeEmpty backboneUseBacterial shuttle vectorAvailable SinceNov. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCDF-cascade
Plasmid#247069PurposeL-arabinose inducible E.coli cascade operon inserted in pCDF vectorDepositorInsertE.coli Type I-E CRISPR cas
UseCRISPR and Synthetic BiologyExpressionBacterialPromoteraraBAD promoterAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGRNA3_LacZ_IB1_IIT1
Plasmid#247080PurposeL-arabinose inducible crRNA of type I-E CRISPR cas (Escherichia coli K-12). encoding 105 nt spacer which targets both Ecoli LacZ B1 and T1 site. riboJ/RNaseIII site are encoded between two crRNADepositorInserttype I-E CRISPR cas crRNA
UseCRISPRExpressionBacterialAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBSII-FRT-MCS
Plasmid#205988PurposeVector containing FRT and FRT-F3 sitesDepositorTypeEmpty backboneUsePcr vectorAvailable SinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJexpress414_OmpA171_R4cons_Y129H
Plasmid#64302PurposeConservative version of OmpA Redesign 4 with Y129H mutationDepositorInsertOmpA_R4cons_Y129H
UseSynthetic BiologyTags6His and FlAsHExpressionBacterialMutation25 mutations to lipid-facing surfacePromoterT7Available SinceAug. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFUdioFRTeYFPW
Plasmid#133998Purposeexpresses eYFP upon coexpression with the recombinase flippase (Flp)DepositorInserteYFP
UseLentiviral; Flp/frtExpressionMammalianMutationinverted and flanked by two incompatible FRT siteā¦PromoterUbCAvailable SinceMay 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSDMA57
Plasmid#67941PurposeComplementation in Cryptococcus neoformans. Targets DNA constructs to a Safe Haven Site, a small gene-free region. Contains NEO resistance marker.DepositorTypeEmpty backboneUseCryptococcal complementation vectorPromoterACT1 for Cryptococcal markerAvailable SinceOct. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSDMA25
Plasmid#67940PurposeComplementation in Cryptococcus neoformans. Targets DNA constructs to a Safe Haven Site, a small gene-free region. Contains nourseothricin resistance marker (NAT)DepositorTypeEmpty backboneUseCryptococcal complementation vectorPromoterACT1 for Cryptococcal markerAvailable SinceOct. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSDMA58
Plasmid#67942PurposeComplementation in Cryptococcus neoformans. Targets DNA constructs to a Safe Haven Site, a small gene-free region. Contains HYG resistance marker.DepositorTypeEmpty backboneUseCryptococcal complementation vectorPromoterACT1 for Cryptococcal markerAvailable SinceOct. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRL1383a
Plasmid#70692PurposeRSF1010-based vector with extensive polylinker, and resistance to Strep and Spec. Shuttle vector suitable for transfer to, and replication in, E. coli and Anabaena (Nostoc) sp. strain PCC 7120.DepositorTypeEmpty backboneUseBacterial shuttle vectorAvailable SinceJan. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMi(3xP3-EGFP)
Plasmid#102540PurposeTransgenesis vector based on the Minos transposon, carrying the 3xP3-EGFP markerDepositorInsertMinos transpoable element with 3xP3-EGFP marker
Available SinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRL1342
Plasmid#70691PurposeRSF1010-based vector with extensive polylinker, and resistance to Cm and Em. Shuttle vector suitable for transfer to, and replication in, E. coli and Anabaena (Nostoc) sp. strain PCC 7120.DepositorTypeEmpty backboneUseBacterial shuttle vectorAvailable SinceNov. 17, 2015AvailabilityAcademic Institutions and Nonprofits only