We narrowed to 13,695 results for: crispr cas9
-
Plasmid#197869PurposeCRISPR/Cas9/sgRNA plasmid for cutting Med6 C terminal and building MED6-mEmerald/Halo knock-in mESCsDepositorAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2
Plasmid#188964PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
Bmpr2 gRNA#2
Plasmid#163389PurposeCas9-mediated knockout of Bmpr2 in mammalian cellsDepositorAvailable SinceAug. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
Bmpr2 gRNA#1
Plasmid#163388PurposeCas9-mediated knockout of Bmpr2 in mammalian cellsDepositorAvailable SinceAug. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
Bmpr2 gRNA#3
Plasmid#163390PurposeCas9-mediated knockout of Bmpr2 in mammalian cellsDepositorAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pROS13_IDH2 #7
Plasmid#166102PurposeThis plasmid express a sgRNA that targets the IDH2 gene. This allows Cas9 to make a double-strand break and facilitate integration of LOV2 at position IDH2-135 by homologous recombination.DepositorArticleAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pROS13_IDH1 #4
Plasmid#166101PurposeThis plasmid express a sgRNA that targets the IDH1 gene. This allows Cas9 to make a double-strand break and facilitate integration of LOV2 at position IDH1-67 by homologous recombination.DepositorArticleAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_22A
Plasmid#91133PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:AtCas9 + AtU6:gRNA, Plant Selection: 2x35S:npt IIDepositorInsertEngineering Reagent: 35S:AtCas9 + AtU6:gRNA
UseCRISPRExpressionPlantAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_25F
Plasmid#91143PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:TaCas9 + TaU6:gRNA, Plant Selection: PvUbi2:hpt IIDepositorInsertEngineering Reagent: ZmUbi:TaCas9 + TaU6:gRNA
UseCRISPRExpressionPlantAvailable SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_21A
Plasmid#91128PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:AtCas9 + AtU6:gRNA, Plant Selection: 2x35S:hpt IIDepositorInsertEngineering Reagent: 35S:AtCas9 + AtU6:gRNA
UseCRISPRExpressionPlantAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pVC-Ds-DrU6a:sgRNA-com-Ds
Plasmid#119077PurposeTo clone sgRNA spacer sequence for microinjections. This sgRNA tracrRNA contains 2x com stem loopsDepositorInsertU6a:2xCom-sgRNA
ExpressionBacterialPromoterZebrafish U6a promoterAvailable SinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVC-Ds-DrU6a:sgRNA-MS2-Ds
Plasmid#119076PurposeTo clone sgRNA spacer sequence for microinjections. This sgRNA tracrRNA contains 2x MS2 stem loopsDepositorInsertU6a:2xMS2-sgRNA
ExpressionBacterialPromoterZebrafish U6a promoterAvailable SinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2804 pHR: U6-SpsgTRE3G CMV-PYL1-VPR-IRES-mCherry
Plasmid#84258PurposeExpresses Sp sgTRE3G gRNA with ABA-inducible VPR and mCherry for OR gateDepositorInsertsSp sgTRE3G
PYL1-VPR
UseCRISPR and LentiviralTagsIRES-mCherry and PYL1ExpressionMammalianPromoterCMV and mouse U6Available SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRN3P_T3_ABE8e_IVT
Plasmid#201676PurposePlasmid to be used as DNA template for in vitro RNA transcription of the ABE8e base editor (A to G) by T3 RNA polymerase. The plasmid contains optimised 5'UTR and 3'UTR to improve protein expression.DepositorInsertecTadA(8e)-nSpCas9
UseCRISPR; Vector for in-vitro transcriptionPromoterT3 promoterAvailable SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_22C
Plasmid#91135PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:Csy4-P2A-AtCas9 + CmYLCV:gRNAs with Csy4 spacers , Plant Selection: 2x35S:npt IIDepositorInsertEngineering Reagent: 35S:Csy4-P2A-AtCas9 + CmYLCV:gRNAs with Csy4 spacers
UseCRISPRExpressionPlantAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_26G
Plasmid#91149PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:TaCas9_dead + TaU6:gRNA , Plant Selection: PvUbi2:barDepositorInsertEngineering Reagent: ZmUbi:TaCas9_dead + TaU6:gRNA
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_23C
Plasmid#91140PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:Csy4-P2A-AtCas9 + CmYLCV:gRNAs with Csy4 spacers , Plant Selection: 2x35S:barDepositorInsertEngineering Reagent: 35S:Csy4-P2A-AtCas9 + CmYLCV:gRNAs with Csy4 spacers
UseCRISPRExpressionPlantAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_21C
Plasmid#91130PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:Csy4-P2A-AtCas9 + CmYLCV:gRNAs with Csy4 spacers , Plant Selection: 2x35S:hpt IIDepositorInsertEngineering Reagent: 35S:Csy4-P2A-AtCas9 + CmYLCV:gRNAs with Csy4 spacers
UseCRISPRExpressionPlantAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCK389.AAV
Plasmid#177327PurposeaTc inducible MCP-SoxS double mutant expression for CRISPRa in E.coli. Contains constitutive dCas9 and scRNA expressionDepositorInsertsSoxS
dCas9
UseCRISPRTagsMCP (MS2 Coat Protein)MutationR93A,S101AAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only