We narrowed to 16,593 results for: grna
-
Plasmid#163457Purposelentiviral vector expressing Cas9 and an sgRNA targeting MPC2DepositorInsertsgRNA 7 targeting GPT2 (MPC2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgMPC2_9
Plasmid#163458Purposelentiviral vector expressing Cas9 and an sgRNA targeting MPC2DepositorInsertsgRNA 9 targeting GPT2 (MPC2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pABM-D4-miR30-L1221
Plasmid#132933PurposeLentivector for luciferase (control) knockdown and blasticidin resistanceDepositorInsertluciferase shRNA
UseLentiviral and RNAiPromoterSFFVAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132D2.0
Plasmid#99890PurposeGolden Gate entry vector to express the 2nd gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under OsU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterOsU3Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFRT/TO/FLAGHA-SCAF8
Plasmid#122470PurposeDox-inducible FLAG/HA (N-terminal tag) SCAF8 expressionDepositorInsertSCAF8 isoform C CRISPR resistant (SCAF8 Human)
TagsFLAGHAExpressionMammalianMutationSynonymous mutations conferring resistance to gRN…PromoterCMVAvailable SinceMay 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSUPER-ARF1b
Plasmid#67494PurposeExpression of shRNA targeting human ARF1bDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSico Spry-2
Plasmid#14809DepositorAvailable SinceApril 5, 2007AvailabilityAcademic Institutions and Nonprofits only -
pSMP-RING1_1
Plasmid#36355DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_VEGFB
Plasmid#183328PurposeAll-in-One CRISPRko system with a guide RNA that targets VEGFB geneDepositorInsertVEGFB
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_VEGFA
Plasmid#183327PurposeAll-in-One CRISPRko system with a guide RNA that targets VEGFA geneDepositorInsertVEGFA
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSUPER.retro.puro-shMePCE_shLARP7
Plasmid#113538PurposeRetroviral vector designed to knock down MePCE and LARP7 simultaneously.DepositorInsertshMePCE and shLARP7 (MEPCE Human)
UseRetroviralAvailable SinceJuly 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSR-siKlf5
Plasmid#41740DepositorInsertKlf5 (Klf5 Mouse)
UseRNAiAvailable SinceJan. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_GART
Plasmid#183296PurposeAll-in-One CRISPRko system with a guide RNA that targets GART geneDepositorInsertGART
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7 shRNA against CRTC3
Plasmid#72712PurposeLentiviral expression of shRNA against CRTC3 (3rd generation)DepositorInsertCRTC3
UseLentiviralTagsCMV-EGFPExpressionMammalianPromoterU6Available SinceFeb. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBS U6 WIP RNAi
Plasmid#11774DepositorAvailable SinceFeb. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
p-mCherry2-sgC9cen
Plasmid#198326PurposeExpresses a guide RNA against a repetitive locus found in the pericentromere of human chromosome 9, with mCherry2 reporterDepositorInsertChr9-CEN guide RNA
ExpressionMammalianPromoterhU6Available SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3B-CDS
Plasmid#136045PurposeUPF3B shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GAAGCCTTGTTCCGATCTAAT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pResQ shDna2'
Plasmid#31952DepositorAvailable SinceSept. 19, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-PPHLN1 ts2
Plasmid#115878PurposePPHLN1 knockdownDepositorAvailable SinceJan. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141-ZmUbi-RZ-Aa3.8.5
Plasmid#158407PurposeExpress single gRNA with Aa3.8.5 scaffold (with four MS2 binding sites) under ZmUbi promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterMaize ubiquitin 1Available SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only