We narrowed to 62,263 results for: SAP
-
Plasmid#145824PurposeBacterial expression of anti-SAPAP2 (Rat) recombinant llama nanobody for use as an immunolabelDepositorInsertanti-SAPAP2 (Rat) recombinant llama nanobody SS44 (Dlgap2 L. glama (llama))
Tags6xHis-HAExpressionBacterialPromoterlacAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
SS88 pComb3xss anti-SAPAP2 nanobody
Plasmid#145825PurposeBacterial expression of anti-SAPAP2 (Rat) recombinant llama nanobody for use as an immunolabelDepositorInsertanti-SAPAP2 (Rat) recombinant llama nanobody SS88 (Dlgap2 L. glama (llama))
Tags6xHis-HAExpressionBacterialPromoterlacAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Pur-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196084Purpose(Empty Backbone) Inducible CRISPRi vector conferring puromycin resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
UseCRISPRExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Pur-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196078Purpose(Empty Backbone) Constitutive CRISPRi vector conferring puromycin resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
ExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-Dio-ASAP5-Kv2.1-WPRE
Plasmid#225708PurposeCre dependent soma-targeted expression of the genetically encoded voltage indicator ASAP5DepositorHas ServiceAAV9InsertASAP5-Kv2.1
UseAAVPromoterEF1αAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(SapI)-hU6gRNA5(BbsI)-PGKpuroBFP-W
Plasmid#72666PurposeLentiviral dual CRISPR gRNA expression vector (human 7SK and human U6 promoters)DepositorInserth7SKgRNA cassette, hU6gRNA cassette, PGKpuroBFP cassette, WPRE
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-CMV-intron-CasRx-pA
Plasmid#192485PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
Anti-SAP102 [N19/2-rat IgG2a] - Chimeric
Plasmid#227076PurposeMammalian expression plasmid of anti-SAP102 (Rattus norvegicus) rat IgG2a R-mAb. Derived from hybridoma N19/2.DepositorInsertAnti-SAP102 (Rattus norvegicus) recombinant mouse monoclonal antibody. (Dlg3 Chimera: M. musculus (mouse)/R. norvegicus (rat))
UseAffinity Reagent/ AntibodyExpressionMammalianPromoterDual CMVAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-mU6gRNA5(SapI)-hU6gRNA5(BbsI)-PGKpuroBFP-W
Plasmid#72667PurposeLentiviral dual CRISPR gRNA expression vector (mouse U6 and human U6 promoters)DepositorInsertmU6gRNA cassette, hU6gRNA cassette, PGKpuroBFP cassette, WPRE
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRS305-LEU2-pINO4-SV40NLS-PfV-GS-Sapphire
Plasmid#203655PurposeYeast integrative vector for the expression of the Sapphire-tagged nuclear localizing 40nm nucGEMs under the INO4 promoter.DepositorArticleInsertPfV
TagsSapphireExpressionYeastAvailable SinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRS403-HIS3-pINO4-SV40NLS-PfV-GS-Sapphire
Plasmid#203658PurposeYeast integrative vector for the expression of the Sapphire-tagged nuclear localizing 40nm GEMs under the HIS3 promoter.DepositorArticleInsertPfV
TagsSapphireExpressionYeastAvailable SinceJuly 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJEP316-pAAV-U6SaCas9gRNA(SapI)-pA Empty Cassette
Plasmid#113693PurposeU6 driven SaCas9 gRNA expression cassette without a gRNA. SapI can be used to clone in gRNAs.DepositorInsertSaCas9 gRNA Cassete
UseAAV and CRISPRAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUBC-Pfv-Sapphire-IRES-H2B-mCherry
Plasmid#203648PurposeMammalian lentiviral vector for the expression of the Sapphire-tagged 40nm GEM under the UBC promoter, with a secondary translation initiation site for H2B-mCherry expression.DepositorArticleInsertPfV
UseLentiviralTagsSapphire-IRES-H2B-mCherryAvailable SinceJuly 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Hyg-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196082Purpose(Empty Backbone) Inducible CRISPRi vector conferring hygromycin B resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
Aminoglycoside phosphotransferase
UseCRISPRExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Hyg-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196076Purpose(Empty Backbone) Constitutive CRISPRi vector conferring hygromycin B resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
ExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Bla-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196080Purpose(Empty Backbone) Inducible CRISPRi vector conferring blasticidin S resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
Blasticidin S deaminase
UseCRISPRExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Bla-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196074Purpose(Empty Backbone) Constitutive CRISPRi vector conferring blasticidin S resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
ExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
GB1-His-SAP25-126-186(pL91)
Plasmid#124387PurposeE.Coli produced SAP25 SID purified by FPLC nickel columnDepositorAvailable SinceMay 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV U6-DR30(sapI)-0.5Syn-CasRX-mCherry-pA
Plasmid#192489PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoter0.5SynAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV U6-DR30(sapI)-0.4CaMKIIa-CasRX-mCherry-pA
Plasmid#192490PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoter0.4CaMKIIaAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-CMV-intron-GFP-pA
Plasmid#192493PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-CMV-intron-MCS-pA
Plasmid#192496PurposeTo express CasRX gRNA and contains MCS to insert coding region of interestDepositorInsertCasRx
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
Anti-SAP97 [K64/15-rat IgG2a] - Chimeric
Plasmid#227077PurposeMammalian expression plasmid of anti-SAP97 (Rattus norvegicus) rat IgG2a R-mAb. Derived from hybridoma K64/15.DepositorInsertAnti-SAP97 (Rattus norvegicus) recombinant mouse monoclonal antibody. (Dlg1 Chimera: M. musculus (mouse)/R. norvegicus (rat))
UseAffinity Reagent/ AntibodyExpressionMammalianPromoterDual CMVAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
5'-3xFLAG Sap30bp+exon_siResist minimal CMV pCDNA5
Plasmid#212085PurposeLR vector for integration of Sap30bp+exon(48nt)_siResist into N2a FRT rtTA3 expression cellsDepositorInsertSap30bp+exon(48nt)_siResist (Sap30bp Mouse)
ExpressionMammalianMutationTCTAACCATCTGCAGGACAAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
5'-3xFLAG Sap30bp-exon minimal CMV pCDNA5
Plasmid#212084PurposeLR vector for integration of Sap30bp-exon_siResist into N2a FRT rtTA3 expression cellsDepositorAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
5'-3xFLAG Sap30bp+exon minimal CMV pCDNA5
Plasmid#212073PurposeLR vector for integration of Sap30bp+exon(48nt) into N2a FRT rtTA3 expression cellsDepositorInsertSap30bp+exon(48nt) (Sap30bp Mouse)
ExpressionMammalianAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
5'-3xFLAG Sap30bp-exon minimal CMV pCDNA5
Plasmid#212072PurposeLR vector for integration of Sap30bp-exon into N2a FRT rtTA3 expression cellsDepositorInsertSap30bp-exon (Sap30bp Mouse)
ExpressionMammalianAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI) 0.5 Syn-intron-hfCas13d-pA
Plasmid#233039PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged hfCas13d from a 0.5 bp synapsin promoterDepositorInsertRfxCas13d-compatible gRNA expression cassette and hfCas13d
UseAAVAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJEP314-pAAV-U6SaCas9gRNA(SapI)-CMV-SaCas9-DIO-pA
Plasmid#113691PurposeU6 driven SaCas9 gRNA expression cassette followed by a CMV driven inverted SaCas9. SaCas9 is floxed to render the system cre-dependent.DepositorInsertSaCas9
UseAAV, CRISPR, and Cre/LoxTagsNLSPromoterCytomegalo Virus(CMV)Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUBC-SV40NLS-PfV-Sapphire-IRES-H2B-mCherry
Plasmid#203652PurposeMammalian lentiviral vector for the expression of the Sapphire-tagged nuclear localizing 40nm nucGEMs under the UBC promoter, with a secondary translation initiation site for H2B-mCherry expression.DepositorArticleInsertPfV
UseLentiviralTagsSapphire-IRES-H2B-mCherryAvailable SinceJuly 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-EFS-CasRx-T2A-mCherry-pA
Plasmid#192481PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoterU6/EFSAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJEP317-pAAV-U6SaCas9gRNA(SapI)-EFS-GFP- KASH-pA
Plasmid#113694PurposeU6 driven SaCas9 gRNA expression cassette without a gRNA. Followed by an EFS driven GFP-KASH in a separate reading frame. SapI can be used to clone in gRNAs.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pACYC-T7-SpCas9(BspMI/SapI/BsaI_cassettes)-T7-gRNA1 (BPK1807)
Plasmid#223065PurposeDual pT7 entry plasmid for SpCas9(6AA) library; bacterial expression plasmid with type IIS RE cassettes around D1135/S1136, G1218/E1219, R1335/T1337 (precursor to MMW94). Expresses a gRNA.DepositorInsertentry vector for human codon opt. bacterial expr. plasmid for SpCas9(6AA_NNS) library, with gRNA targeting EGFP site 1
UseCRISPRTagsNLS(SV40)-3xFLAGExpressionBacterialMutationThree regions of SpCas9 encode type IIS restricti…PromoterDual T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ai170 (TIT2L-ASAP2s-Kv-ICL-tTA2) targeting vector
Plasmid#114435PurposeTarget a Cre-dependent voltage sensor ASAP2s cassette into the mouse TIGRE locusDepositorInsertASAP2s-Kv, tTA2
UseCre/Lox and Mouse TargetingTagsKv2.1 tagPromoterTRE2, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR36(DjCas13d-SapI)-CMV-intron-GFP-pA
Plasmid#192500PurposeTo express DjCas13d compatible gRNA and GFPDepositorInsertDjCas13d
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6-sasgRNA(SapI)_Ple155-CI-EGFP-W3SL_BbsI(GGA)
Plasmid#231367PurposePle155-driven EGFP, also encoding U6-driven sgRNA cassette, with SapI sites to clone crRNA sequenceDepositorInsertEGFP
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6-sasgRNA(SapI)_Ple155-CI-mRuby2-W3SL_BbsI(GGA)
Plasmid#231368PurposePle155-driven mRuby2, also encoding U6-driven sgRNA cassette, with SapI sites to clone crRNA sequenceDepositorInsertmRuby2
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR36(DjCas13d-SapI)-CMV-intron-MCS-pA
Plasmid#233031PurposeTo express a DjCas13d-compatible gRNADepositorInsertDjCas13d-compatible gRNA expression cassette
UseAAVAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI) 0.5 Syn-intron-CasRx-pA
Plasmid#233038PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged CasRx from a 0.5 bp synapsin promoterDepositorInsertRfxCas13d-compatible gRNA expression cassette and CasRx
UseAAVAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only