We narrowed to 240 results for: GCaMP6f
-
Plasmid#197595PurposeLentiviral transfer vector for the neuronal expression of mRuby2-T2A-GCaMP6f (fluorescent reporter for Calcium imaging)DepositorInsertmRuby2-T2A-GCaMP6f
UseLentiviralPromoterhSynIAvailable SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-FAS-GCaMP6f-WPRE
Plasmid#216277PurposeAAV vector with hSynapsin promoter and LoxFAS sites for Cre-Off expression of GCaMP6f (GCaMP6f will not be expressed in neurons that express Cre recombinase)DepositorInsertGCaMP6f
UseAAV and Cre/LoxTags6XHIS and XpressPromoterhuman synapsin 1 (hSyn)Available SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Fon-GCaMP6F
Plasmid#137122PurposeIntersectional viral expression of GCaMP6F in cells expressing both Cre AND FlpDepositorHas ServiceAAV5 and AAV8InsertCon/Fon-GCaMP6F
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationRemoved RSET tagPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-FAS-GCaMP6f-WPRE
Plasmid#141237PurposeAAV vector with Ef1a promoter and LoxFAS sites for Cre-Off expression of GCaMP6f (GCaMP6f will not be expressed in mammalian cells that express Cre recombinase)DepositorInsertGCaMP6f
UseAAV and Cre/LoxTags6XHIS and XpressPromoterHuman elongation factor-1 alpha (EF-1 alpha)Available SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Coff/Fon-GCaMP6F
Plasmid#137124PurposeIntersectional viral expression of GCaMP6F in cells expressing Flp AND NOT CreDepositorHas ServiceAAV8InsertCoff/Fon-GCaMP6F
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationRemoved RSET tagPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
RabV CVS-N2c(deltaG)-GCaMP6f
Plasmid#73466PurposeExpresses GCaMP6f for calcium imagingDepositorInsertGCaMP6f
UseNeurotropic virusAvailable SinceMarch 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ai95(RCL-GCaMP6f) targeting vector
Plasmid#61579PurposeTarget a Cre-dependent GCaMP6-fast expression cassette to the mouse Rosa26 locusDepositorInsertCAG-LSL-GCaMP6-fast
UseCre/Lox and Mouse TargetingPromoterCAGAvailable SinceJuly 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
VV246: CoChR(C108S)-GCaMP6f-ER in fck
Plasmid#58521PurposeExpresses CoChR(C108S) fused to GCaMP6f in mammalian cellsDepositorInsertCoChR(C108S)-GCaMP6f-ER
UseLentiviralTagsGCaMP6fExpressionMammalianMutationchanged Cysteine 108 to SerinePromotera-CamKIIAvailable SinceNov. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-nullCoChR-GCaMP6f-Kv2.1
Plasmid#158758PurposeCell body-targeted GCaMP6f, under synapsin promoter: nullCoChR (the optogenetic protein CoChR mutated to have 0 current), followed by GCaMP6f and the KV2.1 motif (nullCoChR-GCaMP6f-Kv2.1).DepositorInsertnullCoChR-GCaMP6f-Kv2.1
UseAAVExpressionMammalianPromotersynapsin promoterAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
VV247: sdChR(C138S)-TS-GCaMP6f-ER in fck
Plasmid#58522PurposeExpresses sdChR(C138S) fused to GCaMP6f in mammalian cellsDepositorInsertsdChR(C138S)-TS-GCaMP6f-ER
UseLentiviralTagsGCaMP6fExpressionMammalianMutationchanged Cysteine 138 to SerinePromotera-CamKIIAvailable SinceNov. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
CamKII-mito4x-GCaMP6f-IRES2-MCS
Plasmid#212660PurposeExpresses under a CamKII promoter: mito4x-GCaMP6f and a multiple cloning site (MCS) after an IRES sequenceDepositorInsertsUseLentiviralExpressionMammalianMutationD676A, D680AAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
CamKII-mito4x-GCaMP6f-Drosophila-Letm1
Plasmid#212663PurposeExpresses under a CamKII promoter: mito4x-GCaMP6f and Drosophila-Letm1DepositorAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-GCaMP6f-WPRE
Plasmid#216275PurposeAAV vector with hSynapsin promoter and DIO Lox sites for Cre-On expression of green fluorescent calcium indicator GCaMP6fDepositorInsertGCaMP6f
UseAAV and Cre/LoxTags6XHIS and XpressPromoterhuman Synapsin 1 (hSyn)Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-GCaMP6f-4x128-mAGNET
Plasmid#166023PurposeExpresses GCaMP6f in CaMKII+ cells with low miRNA-128 expressionDepositorInsertGCaMP6f with 4 miR-128 binding sites
UseAAV and Mouse TargetingTagsNoneExpressionMammalianAvailable SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-RSV-tdTomato-2A-GCaMP6f
Plasmid#80317PurposeFluorescent reporter for calcium signalingDepositorInsertstdTomato
GCaMP6f
UseLentiviralPromoterRSVAvailable SinceAug. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 gfaABC1D-cyto-GCaMP6f
Plasmid#52925PurposeFluorescent reporter for calcium signalingDepositorHas ServiceAAV5InsertGCaMP6f
UseAAVAvailable SinceJune 23, 2014AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 gfaABC1D-lck-GCaMP6f
Plasmid#52924PurposeFluorescent reporter for calcium signalingDepositorHas ServiceAAV5Insertlck-GCaMP6f
UseAAVTags6xHisAvailable SinceJune 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJMK074: CMV QuasAr2-TS-GCaMP6f
Plasmid#72303PurposeCombines a gCaMP-based calcium indicator and an Arch-based voltage indicatorDepositorInsertCaViar
UseLentiviralTagsTSExpressionMammalianPromoterCMVAvailable SinceMay 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mDlx-GCaMP6f-Fishell-2
Plasmid#83899PurposeGCaMP6f expression in forebrain GABA-ergic interneurons under the control of the mDlx enhancer elementDepositorHas ServiceAAV Retrograde, AAV1, and AAV9InsertGCaMP6f
UseAAVExpressionMammalianPromotermDlxAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only